Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00034186
Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf7 X.
Alternate IDs: WB-STRAIN:SP268, CGC_SP268
Notes: Made_by: Meneely P|"WT PHENOTYPE. Should throw dead eggs."
Proper citation: RRID:WB-STRAIN:WBStrain00034186 Copy
http://www.wormbase.org/db/get?name=WBStrain00034187
Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf8 X.
Alternate IDs: WB-STRAIN:SP269, CGC_SP269
Notes: Made_by: Meneely P|"WT PHENOTYPE."
Proper citation: RRID:WB-STRAIN:WBStrain00034187 Copy
http://www.wormbase.org/db/get?name=WBStrain00034188
Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf9 X.
Alternate IDs: WB-STRAIN:SP270, CGC_SP270
Notes: Made_by: Meneely P|"WT PHENOTYPE."
Proper citation: RRID:WB-STRAIN:WBStrain00034188 Copy
http://www.wormbase.org/db/get?name=WBStrain00034189
Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf10 X.
Alternate IDs: WB-STRAIN:SP271, CGC_SP271
Notes: Made_by: Meneely P|"WT PHENOTYPE"
Proper citation: RRID:WB-STRAIN:WBStrain00034189 Copy
http://www.wormbase.org/db/get?name=WBStrain00034104
Source Database: WormBase (WB)
Affected Genes: WBGene00004013(pha-4)|WBGene00004879(smg-1)
Genomic Alteration: WBGene00004013(pha-4), WBGene00004879(smg-1)
Availability: available
Source References: PMID:32302543
Synonyms: smg-1(cc546) I; pha-4(zu225) V.
Alternate IDs: WB-STRAIN:SM190, CGC_SM190
Notes: Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Made_by: Mary Ellen Domeier"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00034104 Copy
http://www.wormbase.org/db/get?name=WBStrain00034105
Source Database: WormBase (WB)
Affected Genes: WBGene00003937(pax-1)
Genomic Alteration: WBGene00003937(pax-1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SM202
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034105 Copy
http://www.wormbase.org/db/get?name=WBStrain00034190
Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf11 X.
Alternate IDs: WB-STRAIN:SP272, CGC_SP272
Notes: Made_by: Meneely P|"WT PHENOTYPE"
Proper citation: RRID:WB-STRAIN:WBStrain00034190 Copy
http://www.wormbase.org/db/get?name=WBStrain00034192
Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf15 X.
Alternate IDs: WB-STRAIN:SP274, CGC_SP274
Notes: Made_by: Meneely P|"WT PHENOTYPE"
Proper citation: RRID:WB-STRAIN:WBStrain00034192 Copy
http://www.wormbase.org/db/get?name=WBStrain00034193
Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf17 X.
Alternate IDs: WB-STRAIN:SP275, CGC_SP275
Notes: Made_by: Meneely P|"WT PHENOTYPE"
Proper citation: RRID:WB-STRAIN:WBStrain00034193 Copy
http://www.wormbase.org/db/get?name=WBStrain00034194
Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf18 X.
Alternate IDs: WB-STRAIN:SP276, CGC_SP276
Notes: Made_by: Meneely P|"WT PHENOTYPE"
Proper citation: RRID:WB-STRAIN:WBStrain00034194 Copy
http://www.wormbase.org/db/get?name=WBStrain00034195
Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf19 X.
Alternate IDs: WB-STRAIN:SP277, CGC_SP277
Notes: Made_by: Meneely P|"WT PHENOTYPE."
Proper citation: RRID:WB-STRAIN:WBStrain00034195 Copy
http://www.wormbase.org/db/get?name=WBStrain00034196
Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf20 X.
Alternate IDs: WB-STRAIN:SP278, CGC_SP278
Notes: Made_by: Meneely P|"WT PHENOTYPE."
Proper citation: RRID:WB-STRAIN:WBStrain00034196 Copy
http://www.wormbase.org/db/get?name=WBStrain00034153
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00002475(let-246)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00002475(let-246), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
Source References: PMID:6500256
Synonyms: unc-4(e120) let-246(mn99)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:SP210, CGC_SP210
Notes: Hets are WT and segregate WT, paralysed DpyUnc and early larval lethals which are Unc. Maintain by picking WT.
Proper citation: RRID:WB-STRAIN:WBStrain00034153 Copy
http://www.wormbase.org/db/get?name=WBStrain00034155
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00002482(let-253)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00002482(let-253), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
Source References: PMID:6500256
Synonyms: let-253(mn181) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:SP212, CGC_SP212
Notes: Hets are WT and segregate WT, DpyUnc and UncLets. Lethal early larval. Maintain by picking WT.
Proper citation: RRID:WB-STRAIN:WBStrain00034155 Copy
http://www.wormbase.org/db/get?name=WBStrain00034156
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00002474(let-245)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00002474(let-245), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
Source References: PMID:6500256
Synonyms: unc-4(e120) let-245(mn185)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:SP216, CGC_SP216
Notes: Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
Proper citation: RRID:WB-STRAIN:WBStrain00034156 Copy
http://www.wormbase.org/db/get?name=WBStrain00034157
Source Database: WormBase (WB)
Affected Genes: WBGene00006743(unc-3)
Genomic Alteration: WBGene00006743(unc-3)
Availability: available
Source References: PMID:7196363
Synonyms: mnDp1 (X;V)/+ V; unc-3(e151) X.
Alternate IDs: WB-STRAIN:SP219, CGC_SP219
Notes: Pick wild-type to maintain. Segregates lethals. Dp/Dp are homozygous lethal.
Proper citation: RRID:WB-STRAIN:WBStrain00034157 Copy
http://www.wormbase.org/db/get?name=WBStrain00034158
Source Database: WormBase (WB)
Affected Genes: WBGene00002281(let-3)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00002281(let-3), WBGene00006743(unc-3)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1 (X;V)/+ V; unc-3(e151) let-3(mn104) X.
Alternate IDs: WB-STRAIN:SP223, CGC_SP223
Notes: LETHAL EARLY LARVAL Pick WT to maintain.|"Made_by: Meneely P"
Proper citation: RRID:WB-STRAIN:WBStrain00034158 Copy
http://www.wormbase.org/db/get?name=WBStrain00034160
Source Database: WormBase (WB)
Affected Genes: WBGene00002283(let-5)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00002283(let-5), WBGene00006743(unc-3)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1 (X;V)/+ V; let-5(mn106) unc-3(e151) X.
Alternate IDs: WB-STRAIN:SP225, CGC_SP225
Notes: LETHAL LATE LARVAL MATERNAL EFFECT Pick WT to maintain.|"Made_by: Meneely P"
Proper citation: RRID:WB-STRAIN:WBStrain00034160 Copy
http://www.wormbase.org/db/get?name=WBStrain00034161
Source Database: WormBase (WB)
Affected Genes: WBGene00002286(let-9)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00002286(let-9), WBGene00006743(unc-3)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1 (X;V)/+ V; let-9(mn107) unc-3(e151) X.
Alternate IDs: WB-STRAIN:SP226, CGC_SP226
Notes: Pick WT to maintain. Throws WT, Sterile Uncs, and dead eggs(homozygous Dp).
Proper citation: RRID:WB-STRAIN:WBStrain00034161 Copy
http://www.wormbase.org/db/get?name=WBStrain00034162
Source Database: WormBase (WB)
Affected Genes: WBGene00002285(let-7)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00002285(let-7), WBGene00006743(unc-3)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; unc-3(e151) let-7(mn112) X.
Alternate IDs: WB-STRAIN:SP231, CGC_SP231
Notes: LETHAL LATE LARVAL SEX-INFLUENCED Maintain by picking WT.|"Made_by: Meneely P"
Proper citation: RRID:WB-STRAIN:WBStrain00034162 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
