Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037224
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00000381(cct-6)
Genomic Alteration: WBGene00000254(bli-4), WBGene00000381(cct-6)
Availability: available
Source References: EMPTY
Synonyms: cct-6(ok2904) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2279, CGC_VC2279
Notes: F01F1.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2904 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAGTTGGGCTTGTTGAACG. External right primer: CCCTCGAGTTGCTTGAAAAG. Internal left primer: ATTCTGGTTGTGGCTGCTTC. Internal right primer: GCGTGACCTCCTTGTAGAGG. Internal WT amplicon: 1286 bp. Deletion size: 605 bp. Deletion left flank: CCGAGCTTGGCACGTCCCTTCAGGTTCTCA. Deletion right flank: CTTCAGTCTTCTCGTATTCCAAAGAAACGT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037224 Copy
http://www.wormbase.org/db/get?name=WBStrain00037225
Source Database: WormBase (WB)
Affected Genes: WBGene00001089(dre-1)
Genomic Alteration: WBGene00001089(dre-1)
Availability: available
Source References: EMPTY
Synonyms: dre-1(ok2905) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2280, CGC_VC2280
Notes: K04A8.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2905 homozygotes (early larval arrest; escapers may lay eggs that hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGTAGGGATTCGCATGA. External right primer: CCCCTTTCAATTTCGAGTCA. Internal left primer: CAGCCAAAGTATTTCGAGCA. Internal right primer: CAGAAGGTCGAGGGAGACAT. Internal WT amplicon: 1211 bp. Deletion size: 741 bp. Deletion left flank: CTGCTGCCTGCACACTGGATCAGCCCGAAA. Deletion right flank: TTTTTTTCATTATTTCTTATCTCAAAAATG. Insertion Sequence: TCATTTTTTTATCTATCAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037225 Copy
http://www.wormbase.org/db/get?name=WBStrain00037228
Source Database: WormBase (WB)
Affected Genes: WBGene00010329(pcdr-1)
Genomic Alteration: WBGene00010329(pcdr-1)
Availability: available
Source References: EMPTY
Synonyms: F59D12.1(gk1122) X.
Alternate IDs: WB-STRAIN:VC2285, CGC_VC2285
Notes: F59D12.1. Identified by PCR, validated by CGH. External left primer: CTCACAAAAAGGGGCGAATA. External right primer: TACCCCTTACACTAACGGCG. Internal left primer: GGTTGTGTTCTATCCCGACG. Internal right primer: ATGAGTGCTTGGGACTTTGG. Internal WT amplicon: 937 bp. Deletion size: 585 bp. Deletion left flank: ACTAGGTTTTCTGTTTGTCACATTTTTCTT. Deletion right flank: CTTATTTGAATATAAACATTCAAGATTTCT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037228 Copy
http://www.wormbase.org/db/get?name=WBStrain00037229
Source Database: WormBase (WB)
Affected Genes: WBGene00002179(jph-1)
Genomic Alteration: WBGene00002179(jph-1)
Availability: available
Source References: PMID:39381635
Synonyms: jph-1(ok2823) I.
Alternate IDs: WB-STRAIN:VC2286, CGC_VC2286
Notes: T22C1.7. External left primer: TGGAATGTGTGGTTGAAGGA. External right primer: GGTGATCCCTCTGGCTGTAA. Internal left primer: TTGTGAATTGATTGGTGTTTGA. Internal right primer: GGCCTTTCTGGTAGAGGAGG. Internal WT amplicon: 1144 bp. Deletion size: 637 bp. Deletion left flank: TTCGGCATCACATGATTGTGATACGCTTTT. Deletion right flank: AATTTCAAAAATTTCCCTCATAATTTCAAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037229 Copy
http://www.wormbase.org/db/get?name=WBStrain00037226
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00011631(tgs-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00011631(tgs-1)
Availability: available
Source References: EMPTY
Synonyms: T08G11.4(ok2909) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2281, CGC_VC2281
Notes: T08G11.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2909 homozygotes (early to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGATTTCCATGCGACTTTTT. External right primer: GAAATTTGTCGCAAATCGGT. Internal left primer: CTCGACGAGCTGAAAAATGT. Internal right primer: ACGGAGTCGCTTCTTTTCTG. Internal WT amplicon: 1281 bp. Deletion size: 505 bp. Deletion left flank: CAAATGAGACTAATGATGTTCTAAGTATAT. Deletion right flank: CAGTGAATGCATCGACAACAACAGAAACAT. Insertion Sequence: AT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037226 Copy
http://www.wormbase.org/db/get?name=WBStrain00037231
Source Database: WormBase (WB)
Affected Genes: WBGene00006829(unc-101)|WBGene00012354(cox-4)
Genomic Alteration: WBGene00006829(unc-101), WBGene00012354(cox-4)
Availability: available
Source References: EMPTY
Synonyms: W09C5.8(ok2908)/hIn1 [unc-101(sy241)] I.
Alternate IDs: WB-STRAIN:VC2290, CGC_VC2290
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"W09C5.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2908 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCTCGCTACTACCCGCTA. External right primer: CCCGTGTGTTCTGTTGTTTG. Internal left primer: CAGCCCATCTCTCAAGAAGC. Internal right primer: TCCTCTTCCACGTTTCCATC. Internal WT amplicon: 1106 bp. Deletion size: 565 bp. Deletion left flank: CCTTCTCGAGCACAAGCGCACGCTCAACCT. Deletion right flank: AATAAATAACTGGTTTATGGGTTGAAAATG. Insertion Sequence: CAAC."
Proper citation: RRID:WB-STRAIN:WBStrain00037231 Copy
http://www.wormbase.org/db/get?name=WBStrain00037232
Source Database: WormBase (WB)
Affected Genes: WBGene00000209(asg-1)|WBGene00000254(bli-4)
Genomic Alteration: WBGene00000209(asg-1), WBGene00000254(bli-4)
Availability: available
Source References: EMPTY
Synonyms: asg-1(ok2950) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2291, CGC_VC2291
Notes: K07A12.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2950 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCAGTTCTCTCGCTTTTT. External right primer: ATAAGCCAGGATGATGCGAC. Internal left primer: GTAATCCGGATCTTGCTTGG. Internal right primer: ACACTCGAGAGGCTGGAGAA. Internal WT amplicon: 1204 bp. Deletion size: approximately 1203 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037232 Copy
http://www.wormbase.org/db/get?name=WBStrain00037235
Source Database: WormBase (WB)
Affected Genes: WBGene00012302(dot-1.3)
Genomic Alteration: WBGene00012302(dot-1.3)
Availability: available
Source References: EMPTY
Synonyms: W06D11.4(ok2831) X.
Alternate IDs: WB-STRAIN:VC2294, CGC_VC2294
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"W06D11.4. External left primer: CGAAAAACAAAAAGGAGGCA. External right primer: GTTTCCAAACACGCTCCATT. Internal left primer: TATTGAGGAGGAGGGAAGGG. Internal right primer: TTTTCTGGACAAACGCTGAG. Internal WT amplicon: 1279 bp. Deletion size: 970 bp. Deletion left flank: TAGTCAAGTAGAATGGCACTTTTCTACTTG. Deletion right flank: GAACCTTCACGGCATCAAGAATCGGCTTGT."
Proper citation: RRID:WB-STRAIN:WBStrain00037235 Copy
http://www.wormbase.org/db/get?name=WBStrain00037233
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006790(unc-55)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006790(unc-55)
Availability: available
Source References: EMPTY
Synonyms: unc-55(ok2822) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2292, CGC_VC2292
Notes: F55D12.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2822 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGACATGTCGGTTGGGATT. External right primer: GCCGAGAATGAGGAATTCAA. Internal left primer: GAGACGGGGGCATACTGTAG. Internal right primer: ACCACGTGGATTTTCATTCG. Internal WT amplicon: 1112 bp. Deletion size: 492 bp. Deletion left flank: ATCAAGGAGACGGGGGCATACTGTAGGTCA. Deletion right flank: AAACCTTATGTCAAAATTTTTTTTCTGGAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037233 Copy
http://www.wormbase.org/db/get?name=WBStrain00037234
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00015232(B0511.6)
Genomic Alteration: WBGene00000254(bli-4), WBGene00015232(B0511.6)
Availability: available
Source References: EMPTY
Synonyms: B0511.6(ok2948) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2293, CGC_VC2293
Notes: B0511.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1948 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTGTCTTTTCCCTTCTGG. External right primer: CGTTCATTTCCGGTCTTTGT. Internal left primer: TCATAAAATTTGTTAATTTTGCAGG. Internal right primer: CCAATGAACGAAACAACGTG. Internal WT amplicon: 1363 bp. Deletion size: 577 bp. Deletion left flank: TGGACGACTTTTGGATCATCTTCAGAATAC. Deletion right flank: ACAACTCGCGGAAATGTTTTTTATTTAATT.|"B0511.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2948 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTGTCTTTTCCCTTCTGG. External right primer: CGTTCATTTCCGGTCTTTGT. Internal left primer: TCATAAAATTTGTTAATTTTGCAGG. Internal right primer: CCAATGAACGAAACAACGTG. Internal WT amplicon: 1363 bp. Deletion size: 577 bp. Deletion left flank: TGGACGACTTTTGGATCATCTTCAGAATAC. Deletion right flank: ACAACTCGCGGAAATGTTTTTTATTTAATT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037234 Copy
http://www.wormbase.org/db/get?name=WBStrain00037239
Source Database: WormBase (WB)
Affected Genes: WBGene00004221(ptr-6)
Genomic Alteration: WBGene00004221(ptr-6)
Availability: available
Source References: EMPTY
Synonyms: ptr-6(ok2988) II.
Alternate IDs: WB-STRAIN:VC2301, CGC_VC2301
Notes: C54A12.1. External left primer: AAAATGATGTTCCTTTGCCG. External right primer: GCTCTTGTGGTTCGGAATGT. Internal left primer: CAAGAGCTGAAATTTTGAATAGGA. Internal right primer: ACACTCATCGCTCCGTTCTT. Internal WT amplicon: 1379 bp. Deletion size: 493 bp. Deletion left flank: TCTCTGAAATGATGGAAATGTAAAAAGGTA. Deletion right flank: CAAAGAAGGTGATTTGATAAAGGAATGTGA. Insertion Sequence: CAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037239 Copy
http://www.wormbase.org/db/get?name=WBStrain00037238
Source Database: WormBase (WB)
Affected Genes: WBGene00008882(F16B12.6)
Genomic Alteration: WBGene00008882(F16B12.6)
Availability: available
Source References: EMPTY
Synonyms: F16B12.6(gk1118) X.
Alternate IDs: WB-STRAIN:VC2300, CGC_VC2300
Notes: F16B12.6. Identified by PCR, validated by CGH. External left primer: CGATCACCAACAAACAATGC. External right primer: TACGTGACCCGTTGACAAAA. Internal left primer: CAGTTTAGAAATGCCTCGCC. Internal right primer: CGGACCGTCGTAAACAAACT. Internal WT amplicon: 2674 bp. Deletion size: 2358 bp. Deletion left flank: ATTGTGAAAACAAAAAAAAACAGATGAAGC. Deletion right flank: GCAATTCTTCAATCATTTCAGGTTTTCTAT. Insertion Sequence: AGATGA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037238 Copy
http://www.wormbase.org/db/get?name=WBStrain00037243
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00010478(dkc-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00010478(dkc-1)
Availability: available
Source References: EMPTY
Synonyms: K01G5.5(ok2795) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2307, CGC_VC2307
Notes: K01G5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2795 homozygotes (early larval arrest, Dpy or Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACTTCCATCCTCGAAC. External right primer: CCTCCTCCTCTTCCTCGTCT. Internal left primer: CGCACCAATCACTACACACC. Internal right primer: GGCGTCTCCTCTTTCTTGAC. Internal WT amplicon: 1149 bp. Deletion size: 997 bp. Deletion left flank: GGGAGTATCACCATTAAAGCGTGACATCAA. Deletion right flank: ATTCGGAAAACCAAATGACACTACTCCAAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037243 Copy
http://www.wormbase.org/db/get?name=WBStrain00037240
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: C52G5(gk1233) X.
Alternate IDs: WB-STRAIN:VC2302, CGC_VC2302
Notes: C52G5. Identified by PCR, validated by CGH. External left primer: TCTTGGCTTTCTGACGTGTG. External right primer: CGTCGTTGGCAAAGGTAAAT. Internal left primer: GTTGAGTGAGCAATGACGGA. Internal right primer: TGCGAAATTTACGCCATACA. Internal WT amplicon: 2398 bp. Deletion size: 977 bp. Deletion left flank: CAGGAACGATTTGCAAACTTCCTGTATAAT. Deletion right flank: GAAAATATCACTAGATATTCTCTTATTCCT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037240 Copy
http://www.wormbase.org/db/get?name=WBStrain00037241
Source Database: WormBase (WB)
Affected Genes: WBGene00010177(F57A8.1)
Genomic Alteration: WBGene00010177(F57A8.1)
Availability: available
Source References: EMPTY
Synonyms: F57A8.1(gk1088) V.
Alternate IDs: WB-STRAIN:VC2303, CGC_VC2303
Notes: F57A8.1. External left primer: GCAAGTCGAAGAAACTTCCG. External right primer: CAAAATGTCCATCATTCCCC. Internal left primer: TCCGTGCGAAATTATGTTCA. Internal right primer: AACCTTTCCGTTTCATCACG. Internal WT amplicon: 2669 bp. Deletion size: 1244 bp. Deletion left flank: AAAATCGCAGAAACATAACGGGTAGAACAA. Deletion right flank: GATAGTGGGGTCGTGGTGGTGTGGGGGAGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037241 Copy
http://www.wormbase.org/db/get?name=WBStrain00037208
Source Database: WormBase (WB)
Affected Genes: WBGene00010351(cbd-1)
Genomic Alteration: WBGene00010351(cbd-1)
Availability: available
Source References: PMID:38816072
Synonyms: cbd-1(ok2913) IV.
Alternate IDs: WB-STRAIN:VC2258, CGC_VC2258
Notes: H02I12.1. External left primer: AAACCAGTAGCCCTCCGTTT. External right primer: TGGATCTTTCCCATTCTTGC. Internal left primer: TGCAGCGATGATTCTGTCTT. Internal right primer: GTCGAGGGATGAAGAATGGA. Internal WT amplicon: 1127 bp. Deletion size: 646 bp. Deletion left flank: ACTACGCCGACGGTTGCAATGACGTATTCT. Deletion right flank: CGTATCTTGAGAATCCATTCTTCATCCCTC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037208 Copy
http://www.wormbase.org/db/get?name=WBStrain00037209
Source Database: WormBase (WB)
Affected Genes: WBGene00021885(Y54G2A.20)
Genomic Alteration: WBGene00021885(Y54G2A.20)
Availability: available
Source References: EMPTY
Synonyms: Y54G2A.20(gk1017) IV.
Alternate IDs: WB-STRAIN:VC2260, CGC_VC2260
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48G2A.20. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 415 bp. Deletion left flank: TGTCATCCAATAAAACCATTTTGTGAGAGT. Deletion right flank: GGAAATTTCCATCTTCTGATTAGAGGTCAA."
Proper citation: RRID:WB-STRAIN:WBStrain00037209 Copy
http://www.wormbase.org/db/get?name=WBStrain00037202
Source Database: WormBase (WB)
Affected Genes: WBGene00022577(nstp-3)
Genomic Alteration: WBGene00022577(nstp-3)
Availability: available
Source References: EMPTY
Synonyms: nstp-3(ok2873) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2250, CGC_VC2250
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZC250.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2873 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTATCCCAAATTCCCTT. External right primer: CGTTTCATTGGGATACCTGG. Internal left primer: TTTTTGCAAATTTCCATCCG. Internal right primer: AATCTTGGCATCCACCTCAC. Internal WT amplicon: 1225 bp. Deletion size: 429 bp. Deletion left flank: TTAATAGGAAGCTGAGAATGTCAATTTTTG. Deletion right flank: AACTGATGAAAAATGGAAGAATTTAGGAAA."
Proper citation: RRID:WB-STRAIN:WBStrain00037202 Copy
http://www.wormbase.org/db/get?name=WBStrain00037288
Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: EMPTY
Synonyms: unc-22(gk1237gk1238) IV.
Alternate IDs: WB-STRAIN:VC2366, CGC_VC2366
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Unc-22 twitcher. The gk1237 lesion is a point mutation (C to A) with flanks TTCCATATGGATTGGACACCTCGACTGTGT and CTCTCCAGCATCAATGTCCCAAACTTCCTT. The gk1238 lesion is a 122-bp deletion with flanks CTCCATCACTTGCTTCGAATCTATATCTGC and ACGATTTGTGGGCGACTTCCACCGGATTCC, and a single inserted base (C) at the break. Primers to amplify the region are: cggatgcttggaacaaagtt and tgctcgtgtcactggacttc. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk1237gk1238), it is homozygous for 90 other mutations determined from sequence data. All mutations are annotated in WormBase."
Proper citation: RRID:WB-STRAIN:WBStrain00037288 Copy
http://www.wormbase.org/db/get?name=WBStrain00037289
Source Database: WormBase (WB)
Affected Genes: WBGene00003714(nhr-124)
Genomic Alteration: WBGene00003714(nhr-124)
Availability: available
Source References: EMPTY
Synonyms: nhr-124(gk1074) V.
Alternate IDs: WB-STRAIN:VC2370, CGC_VC2370
Notes: C17E7.8. External left primer: GAGTTGTTCATGAGCGCAAA. External right primer: TGTTTAAAAGTTGACCCGCC. Internal left primer: TAAGTCGCATTCACGGTTTG. Internal right primer: AGTCACGTCCGTCCAACTTC. Internal WT amplicon: 1629 bp. Deletion size: 895 bp. Deletion left flank: TTTTTAATTAACAAAAAAACATAATAAAAC. Deletion right flank: TGGAGAATAAGAATGTTCTTTCCGGACAAG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037289 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
