Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00029987
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wgEx75.
Alternate IDs: WB-STRAIN:OP75, CGC_OP75
Notes: Made_by: modEncode|"Modern strain"|"wgEx75 [elt-3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"|"wgIs75 [elt-3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"
Proper citation: RRID:WB-STRAIN:WBStrain00029987 Copy
http://www.wormbase.org/db/get?name=WBStrain00029986
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wgIs74.
Alternate IDs: WB-STRAIN:OP74, CGC_OP74
Notes: Made_by: modEncode|"wgIs74 [hlh-8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"
Proper citation: RRID:WB-STRAIN:WBStrain00029986 Copy
http://www.wormbase.org/db/get?name=WBStrain00029938
Source Database: WormBase (WB)
Affected Genes: WBGene00000445(ceh-22)
Genomic Alteration: WBGene00000445(ceh-22)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:OK0029
Notes: Retired following removal of zero padded strain public_names.
Proper citation: RRID:WB-STRAIN:WBStrain00029938 Copy
http://www.wormbase.org/db/get?name=WBStrain00029934
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003100(mab-3)
Genomic Alteration: WBGene00001864(him-5), WBGene00003100(mab-3)
Availability: available
Source References: PMID:38880276
Synonyms: mab-3(ot931[mab-3::GFP::3xFlag]) II; him-5 (e1490) V.
Alternate IDs: WB-STRAIN:OH15732, CGC_OH15732
Notes: GFP and 3xFlag tag inserted in endogenous mab-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: ggtcaaaattatagatctt Insertion site: II: 9737290-9737291. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
Proper citation: RRID:WB-STRAIN:WBStrain00029934 Copy
http://www.wormbase.org/db/get?name=WBStrain00029936
Source Database: WormBase (WB)
Affected Genes: WBGene00000483(che-1)
Genomic Alteration: WBGene00000483(che-1)
Availability: available
Source References: EMPTY
Synonyms: che-1(ot63 ot941[che-1::SEC-GFP::TEV::3xFLAG]) I.
Alternate IDs: WB-STRAIN:OH15815, CGC_OH15815
Notes: Made_by: Eduardo Leyva-Diaz|"ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37."
Proper citation: RRID:WB-STRAIN:WBStrain00029936 Copy
http://www.wormbase.org/db/get?name=WBStrain00029935
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00012832(dmd-3)
Genomic Alteration: WBGene00001867(him-8), WBGene00012832(dmd-3)
Availability: available
Source References: PMID:37039075
Synonyms: dmd-3(ot932[dmd-3::GFP::3xFlag]); him-8 (e1489) IV.
Alternate IDs: WB-STRAIN:OH15733, CGC_OH15733
Notes: DMD-3::GFP endogenous tag|"GFP and 3xFlag tag inserted in endogenous dmd-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: accctttcagccgtattgt Insertion site: V: 19650564-19650565. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078."
Proper citation: RRID:WB-STRAIN:WBStrain00029935 Copy
http://www.wormbase.org/db/get?name=WBStrain00029931
Source Database: WormBase (WB)
Affected Genes: WBGene00006756(unc-17)
Genomic Alteration: WBGene00006756(unc-17)
Availability: available
Source References: EMPTY
Synonyms: unc-17(ot907[unc-17::mKate2::3xflag]) IV.
Alternate IDs: WB-STRAIN:OH15568, CGC_OH15568
Notes: Superficially wild-type. mKate2 and 3xFlag tag added to endogenous unc-17 locus. unc-17::mKate2 labels all cholinergic neurons in the nervous system. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
Proper citation: RRID:WB-STRAIN:WBStrain00029931 Copy
http://www.wormbase.org/db/get?name=WBStrain00029927
Source Database: WormBase (WB)
Affected Genes: WBGene00016216(pals-22)
Genomic Alteration: WBGene00016216(pals-22)
Availability: available
Source References: EMPTY
Synonyms: pals-22(ot811) III; otIs381 V
Alternate IDs: WB-STRAIN:OH15179, CGC_OH15179
Notes: Made_by: Eduardo Leyva-Diaz|"otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. pals-22(ot811) mutant shows transgene-silencing phenotype. Pan-neuronal nuclear GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Daz E, et al. Genetics (2017), 207(2):529-545."
Proper citation: RRID:WB-STRAIN:WBStrain00029927 Copy
http://www.wormbase.org/db/get?name=WBStrain00029926
Source Database: WormBase (WB)
Affected Genes: WBGene00016216(pals-22)
Genomic Alteration: WBGene00016216(pals-22)
Availability: available
Source References: EMPTY
Synonyms: pals-22(ot810) III; otIs381 V.
Alternate IDs: WB-STRAIN:OH15178, CGC_OH15178
Notes: Made_by: Eduardo Leyva-Diaz|"otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. pals-22(ot810) mutant shows transgene-silencing phenotype. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Daz E, et al. Genetics (2017), 207(2):529-545."
Proper citation: RRID:WB-STRAIN:WBStrain00029926 Copy
http://www.wormbase.org/db/get?name=WBStrain00029928
Source Database: WormBase (WB)
Affected Genes: WBGene00006818(unc-86)
Genomic Alteration: WBGene00006818(unc-86)
Availability: available
Source References: EMPTY
Synonyms: unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III.
Alternate IDs: WB-STRAIN:OH15227, CGC_OH15227
Notes: Made_by: Eduardo Leyva-Diaz|"unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press)."
Proper citation: RRID:WB-STRAIN:WBStrain00029928 Copy
http://www.wormbase.org/db/get?name=WBStrain00029922
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004010(pha-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00004010(pha-1)
Availability: available
Source References: EMPTY
Synonyms: pha-1(e2123) III; him-5(e1490) V; otEx7020.
Alternate IDs: WB-STRAIN:OH15128, CGC_OH15128
Notes: otEx7020 [srg-64p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
Proper citation: RRID:WB-STRAIN:WBStrain00029922 Copy
http://www.wormbase.org/db/get?name=WBStrain00029924
Source Database: WormBase (WB)
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: available
Source References: EMPTY
Synonyms: pha-1(e2123) III; otEx7036.
Alternate IDs: WB-STRAIN:OH15144, CGC_OH15144
Notes: Made_by: Eduardo Leyva-Diaz|"otEx7036 [pals-22p::GFP::unc-54 3'UTR + pha-1(+)]. Transcriptional reporter containing pals-22 promoter (coordinates -791 to -1 from start). Maintain at 25C to select for otEx7036. Reference: Leyva-Daz E, et al. Genetics (2017), 207(2):529-545."
Proper citation: RRID:WB-STRAIN:WBStrain00029924 Copy
http://www.wormbase.org/db/get?name=WBStrain00030035
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wgEx162.
Alternate IDs: WB-STRAIN:OP162, CGC_OP162
Notes: Made_by: modEncode|"Modern strain"|"wgEx162 [unc-4::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"|"wgIs162 [unc-4::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"
Proper citation: RRID:WB-STRAIN:WBStrain00030035 Copy
http://www.wormbase.org/db/get?name=WBStrain00030038
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:37427543
Synonyms: unc-119(ed3) III; wgIs168.
Alternate IDs: WB-STRAIN:OP168, CGC_OP168
Notes: Generated from Paper data WBPaper00060123|"Made_by: modEncode"|"wgIs168 [ceh-7::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"
Proper citation: RRID:WB-STRAIN:WBStrain00030038 Copy
http://www.wormbase.org/db/get?name=WBStrain00030036
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wgIs164.
Alternate IDs: WB-STRAIN:OP164, CGC_OP164
Notes: Made_by: DKV/MC/PW|"Modern strain"|"wgIs164 [fax-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)."
Proper citation: RRID:WB-STRAIN:WBStrain00030036 Copy
http://www.wormbase.org/db/get?name=WBStrain00030044
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wgIs175.
Alternate IDs: WB-STRAIN:OP175, CGC_OP175
Notes: Made_by: modEncode|"Modern strain"|"wgIs175 [lir-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"
Proper citation: RRID:WB-STRAIN:WBStrain00030044 Copy
http://www.wormbase.org/db/get?name=WBStrain00030042
Source Database: WormBase (WB)
Affected Genes: WBGene00006778(unc-42)
Genomic Alteration: WBGene00006778(unc-42)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3);wgIs173[WRM0636D_G10(pRedFlp-Hgr)::unc-119-Nat(unc-42[23849]::2XTY1-eGFP(C.ele)-3XFLAG)dFRT]
Alternate IDs: WB-STRAIN:OP173
Notes: Imported directly from the transgeneOme database.|"Modern strain"
Proper citation: RRID:WB-STRAIN:WBStrain00030042 Copy
http://www.wormbase.org/db/get?name=WBStrain00030040
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:OP170
Notes: Modern strain
Proper citation: RRID:WB-STRAIN:WBStrain00030040 Copy
http://www.wormbase.org/db/get?name=WBStrain00030013
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wgIs115.
Alternate IDs: WB-STRAIN:OP115, CGC_OP115
Notes: Made_by: EAP/DKV/JIM|"Modern strain"|"wgIs115 [dmd-5::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)."
Proper citation: RRID:WB-STRAIN:WBStrain00030013 Copy
http://www.wormbase.org/db/get?name=WBStrain00030010
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:37643611, PMID:38483903
Synonyms: unc-119(ed3) III; wgIs109 [blmp-1::TY1::EGFP::3xFLAG + unc-119(+)]
Alternate IDs: WB-STRAIN:OP109, CGC_OP109
Notes: Made_by: modEncode|"Modern strain"|"Supplementary_genotype unc-119(ed3) III; wgIs109[blmp-1::TY1::EGFP::3xFLAG + unc-119(+)]"|"wgIs109 [blmp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of blmp-1 coding sequence of fosmid ID#WRM0622cF11 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"
Proper citation: RRID:WB-STRAIN:WBStrain00030010 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
