Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037863
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009385(sas-5)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009385(sas-5)
Availability: available
Source References: EMPTY
Synonyms: +/nT1 IV; sas-5(gk5038[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V.
Alternate IDs: WB-STRAIN:VC3975, CGC_VC3975
Notes: Made_by: Vancouver KO Group|"Recessive lethal deletion balanced by nT1. Deletion of 1442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCAGCTTCCACAAGAAAGGACAAAACCCC; Right flanking sequence: GGTACCTGAGACTCCAGCTGAACGAGAACG. See WormBase Variation gk5038 for details."
Proper citation: RRID:WB-STRAIN:WBStrain00037863 Copy
http://www.wormbase.org/db/get?name=WBStrain00037860
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: Y69A2AR.32(gk5043[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC3967, CGC_VC3967
Notes: Homozygous viable. Deletion of 1554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCGAAACAATGATAATTATCACGATCAAC; Right flanking sequence: CTGATGTCCACTCCGATGCCGCCTCCAGGA. See WormBase Variation gk5043 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037860 Copy
http://www.wormbase.org/db/get?name=WBStrain00037861
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007591(zipt-13)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007591(zipt-13)
Availability: available
Source References: EMPTY
Synonyms: zipt-13(gk5051[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC3973, CGC_VC3973
Notes: Homozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTGTCAGAGCAATGTTGAGAAATCCTCCT; Right flanking sequence: GTCCTTGTTGAGCATGTATCGCAATGCAAG. See WormBase Variation gk5051 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037861 Copy
http://www.wormbase.org/db/get?name=WBStrain00037866
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016412(mrps-26)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016412(mrps-26)
Availability: available
Source References: EMPTY
Synonyms: mrps-26(gk5010[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:VC3983, CGC_VC3983
Notes: Made_by: Vancouver KO Group|"Recessive lethal deletion balanced by qC1. Deletion of 993 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGACGATGTCTTTTGGCATCTGCCATGTC; Right flanking sequence: GGACATGATGTGAGTTATTTTTGAACATCG. See WormBase Variation gk5010 for details."
Proper citation: RRID:WB-STRAIN:WBStrain00037866 Copy
http://www.wormbase.org/db/get?name=WBStrain00037900
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: ech-1.1(gk5134[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Alternate IDs: WB-STRAIN:VC4060, CGC_VC4060
Notes: Homozygous viable. Deletion of 2429 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTGGTTTTAGCTATAAAATTGTCCTCCA ; Right flanking sequence: TGCGGTAGTGACAAGCAAGGGCGATTTCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037900 Copy
http://www.wormbase.org/db/get?name=WBStrain00037865
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: PMID:38302462
Synonyms: F59G1.4(gk5058[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Alternate IDs: WB-STRAIN:VC3981, CGC_VC3981
Notes: Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTACAATAGAGTTCCACTAACGCCAACT; Right flanking sequence: TTTGGTAATTTGCCAAAATTCGACGGTCAT. See WormBase Variation gk5058 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037865 Copy
http://www.wormbase.org/db/get?name=WBStrain00037879
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: ZK616.1(gk5090[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC4018, CGC_VC4018
Notes: Homozygous viable. Deletion of 2060 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACATTTATTCCTGTTTCACTACATCATGAT ; Right flanking sequence: ACACTCCGTTTTGAACGTAGAAAAGTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037879 Copy
http://www.wormbase.org/db/get?name=WBStrain00037873
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00023520(oig-5)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00023520(oig-5)
Availability: available
Source References: EMPTY
Synonyms: oig-5(gk5072[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC4000, CGC_VC4000
Notes: Homozygous viable. Deletion of 2650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTTCTCTGGTGGTAGCGATGATGGTAGAA; Right flanking sequence: GGCTGAAATCAATGCGTGGTAGCCTAAAGA. See WormBase Variation gk5072 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037873 Copy
http://www.wormbase.org/db/get?name=WBStrain00037871
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: F25H2.3(gk5066[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Alternate IDs: WB-STRAIN:VC3994, CGC_VC3994
Notes: Homozygous viable. Deletion of 1526 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCACAATTACGATCAGGTTTTATGTATG; Right flanking sequence: TATTTTTAGAGATCTTCAAACGAAGATCAG. See WormBase Variation gk5066 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037871 Copy
http://www.wormbase.org/db/get?name=WBStrain00037872
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018157(lron-6)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018157(lron-6)
Availability: available
Source References: EMPTY
Synonyms: lron-6(gk5068[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Alternate IDs: WB-STRAIN:VC3996, CGC_VC3996
Notes: Homozygous viable. Deletion of 1960 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACAGACCACTCAACATAGCCATCACTTCG; Right flanking sequence: TGATACCGTGTGCTTGAGCATGAAGTGGAT. See WormBase Variation gk5068 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037872 Copy
http://www.wormbase.org/db/get?name=WBStrain00037877
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009842(igeg-2)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009842(igeg-2)
Availability: available
Source References: EMPTY
Synonyms: igeg-2(gk5080[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4007, CGC_VC4007
Notes: Homozygous viable. Deletion of 1974 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGCTATTGTGTCACCGTTCCTCTGTCCA ; Right flanking sequence: ACAGGAATGAGGGAGTGTCAAGGAAAAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037877 Copy
http://www.wormbase.org/db/get?name=WBStrain00037875
Source Database: WormBase (WB)
Affected Genes: WBGene00007349(C05G5.3)|WBGene00044579(C06E2.9)
Genomic Alteration: WBGene00007349(C05G5.3), WBGene00044579(C06E2.9)
Availability: available
Source References: EMPTY
Synonyms: C06E2.9(gk5074) C05G5.3(gk5075) X.
Alternate IDs: WB-STRAIN:VC4002, CGC_VC4002
Notes: Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037875 Copy
http://www.wormbase.org/db/get?name=WBStrain00037846
Source Database: WormBase (WB)
Affected Genes: WBGene00000702(col-128)
Genomic Alteration: WBGene00000702(col-128)
Availability: available
Source References: EMPTY
Synonyms: col-128(gk5030) IV.
Alternate IDs: WB-STRAIN:VC3942, CGC_VC3942
Notes: Homozygous viable. Splicing defect identified by amplicon sequencing.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037846 Copy
http://www.wormbase.org/db/get?name=WBStrain00037847
Source Database: WormBase (WB)
Affected Genes: WBGene00017397(F12A10.8)
Genomic Alteration: WBGene00017397(F12A10.8)
Availability: available
Source References: EMPTY
Synonyms: F12A10.8(gk5033) II.
Alternate IDs: WB-STRAIN:VC3945, CGC_VC3945
Notes: Homozygous viable. Nonsense allele identified by amplicon sequencing.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037847 Copy
http://www.wormbase.org/db/get?name=WBStrain00037840
Source Database: WormBase (WB)
Affected Genes: WBGene00000472(cey-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000472(cey-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: cey-1(gk5004[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Alternate IDs: WB-STRAIN:VC3925, CGC_VC3925
Notes: Homozygous viable. Deletion of 1155 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTCTCTTAATTACTACGAGTGTTACTGG; Right flanking sequence: CGGCTGTTACTTCGTGTGGCGCGACACAAC. See WormBase Variation gk5004 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037840 Copy
http://www.wormbase.org/db/get?name=WBStrain00037845
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: Y57G11A.5(gk5018[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC3940, CGC_VC3940
Notes: Homozygous viable. Deletion of 1099 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCAGTTTTTACACTTTTAAATATGTTA; Right flanking sequence: GGGTACTTGGTTGTCAGAGCTATTGCTTTT. See WormBase Variation gk5018 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037845 Copy
http://www.wormbase.org/db/get?name=WBStrain00037842
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006672(twk-18)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006672(twk-18), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: twk-18(gk5009[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC3930, CGC_VC3930
Notes: Homozygous viable. Deletion of 3495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCATTCTGGGCGAATTTATGATTGCCAATA; Right flanking sequence: GAAGTTGTCCGTGTTGAGCATTTCAATCAC. See WormBase Variation gk5009 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037842 Copy
http://www.wormbase.org/db/get?name=WBStrain00037843
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: PMID:37127715
Synonyms: R01B10.6(gk5008[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Alternate IDs: WB-STRAIN:VC3933, CGC_VC3933
Notes: Homozygous viable. Deletion of 1561 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATAAAGGCAAAGTAGAAAATGACCAGCGAG; Right flanking sequence: ATAGGAAAACAAATATTGTTAAAAAATTTA. See WormBase Variation gk5008 for details.|"Made_by: Vancouver KO Group"|"seip-1 knockout strain"
Proper citation: RRID:WB-STRAIN:WBStrain00037843 Copy
http://www.wormbase.org/db/get?name=WBStrain00037859
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: Y57G11C.36(gk5042[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC3966, CGC_VC3966
Notes: Homozygous viable. Deletion of 1197 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCCGAAAAGATGGGAATTGGCGATACGGA; Right flanking sequence: tcaggcagaagatgactctgaaattaaaaa. See WormBase Variation gk5042 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037859 Copy
http://www.wormbase.org/db/get?name=WBStrain00037858
Source Database: WormBase (WB)
Affected Genes: WBGene00015889(C17C3.3)|WBGene00021032(clec-118)
Genomic Alteration: WBGene00015889(C17C3.3), WBGene00021032(clec-118)
Availability: available
Source References: EMPTY
Synonyms: clec-118(gk5049) C17C3.3(gk5048) II.
Alternate IDs: WB-STRAIN:VC3965, CGC_VC3965
Notes: Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037858 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.