Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 171 showing 3401 ~ 3420 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00037731

http://www.wormbase.org/db/get?name=WBStrain00037731

Source Database: WormBase (WB)
Affected Genes: WBGene00000253(bli-3)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00000253(bli-3), WBGene00003056(lon-2)
Availability: available
Source References: EMPTY
Synonyms: bli-3(gk3069)/szT1 [lon-2(e678)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:VC3226, CGC_VC3226
Notes: Apparent homozygous lethal deletion chromosome (gk3069 in F56C11.1) balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk3069 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTGCAAATGAAGGAGCATC. External right primer: CTTCACACCGTTGGACATTG. Internal left primer: TCCACAACTGAACACTCCGA. Internal right primer: TTCAGGAAGCATTCTTTGGG. Internal WT amplicon: 1399 bp. Deletion size: 443 bp. Deletion left flank: CTGAACACTCCGATTTTGGATTGCTGCAAA. Deletion right flank: AGGAAATATACTTTACGGCAACGAACTCTG.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037731 Copy   


  • RRID:WB-STRAIN:WBStrain00037734

http://www.wormbase.org/db/get?name=WBStrain00037734

Source Database: WormBase (WB)
Affected Genes: WBGene00001630(gly-5)
Genomic Alteration: WBGene00001630(gly-5)
Availability: available
Source References: EMPTY
Synonyms: gly-5(gk3119) III.
Alternate IDs: WB-STRAIN:VC3230, CGC_VC3230
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y39E4B.12. External left primer: GAAAAGGCAAAATACGACAAGG. External right primer: AATCGCGAAAAATTTCCAGTAA. Internal left primer: CAAAAATGTTGTCGATTTACGAAG. Internal right primer: CTTTTCTTACCAAGCATCGAATTT. Internal WT amplicon: 1049 bp. Deletion size: 233 bp. Deletion left flank: AGCGTGAGGGATTGATTCGAGCAAGACTTC. Deletion right flank: AATTTTGTGTCAAAAAATGGAAGGTAAAAA. Validation: gk3119 passed by CGH."

Proper citation: RRID:WB-STRAIN:WBStrain00037734 Copy   


  • RRID:WB-STRAIN:WBStrain00037735

http://www.wormbase.org/db/get?name=WBStrain00037735

Source Database: WormBase (WB)
Affected Genes: WBGene00000499(chk-2)
Genomic Alteration: WBGene00000499(chk-2)
Availability: available
Source References: EMPTY
Synonyms: chk-2(ok3037) V.
Alternate IDs: WB-STRAIN:VC3236, CGC_VC3236
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y60A3A.12. Strongly Him, sickly, slow-growing. External left primer: GAGTTTTAGCGATTGCTCGG. External right primer: CGCGATTTTCGTATTTTCGT. Internal left primer: AAATTTCAAGGTTTTCGGCA. Internal right primer: GCGCAATTTTCTTCGTTTTT. Internal WT amplicon: 1171 bp. Deletion size: 390 bp. Deletion left flank: CGCCCGTACCACTGATCGATCGGATTTCTT. Deletion right flank: CAGTAGAAAACTACTCTATCAATGGAAAAT."

Proper citation: RRID:WB-STRAIN:WBStrain00037735 Copy   


  • RRID:WB-STRAIN:WBStrain00037705

http://www.wormbase.org/db/get?name=WBStrain00037705

Source Database: WormBase (WB)
Affected Genes: WBGene00001953(hlh-8)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00001953(hlh-8), WBGene00003056(lon-2)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; hlh-8(ok1248)/szT1 X.
Alternate IDs: WB-STRAIN:VC3167, CGC_VC3167
Notes: C02B8.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1248 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCGCGGTAATTTTTCAAC. External right primer: GCATCAGACAGTGTGGAGGA. Internal left primer: CCTTTCTTTTCACCGAGCAG. Internal right primer: GAGGGGGAATATGTGCTGAA. Internal WT amplicon: 3385 bp. Deletion size: 2391 bp. Deletion left flank: GAGCATGTGCCAACAGACGGGAACGTCAAA. Deletion right flank: AACATGTTCATAAACTTAGCATTTTCCGCT. Insertion Sequence: A.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037705 Copy   


  • RRID:WB-STRAIN:WBStrain00037706

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037706

Source Database: WormBase (WB)
Affected Genes: WBGene00007630(har-1)
Genomic Alteration: WBGene00007630(har-1)
Availability: available
Source References: EMPTY
Synonyms: har-1(gk3124) III.
Alternate IDs: WB-STRAIN:VC3169, CGC_VC3169
Notes: C16C10.11. External left primer: TTGGCTGCTTGTATCGATTG. External right primer: CGAAAGACTGCGAGGAAAAC. Internal left primer: GTTTCCCTGTCGTATTTCGC. Internal right primer: ATCATTGAATCCGTTGCACA. Internal WT amplicon: 855 bp. Deletion size: 260 bp. Deletion left flank: CAGACAAGTGATTTTTGAACTATTTCGTCA. Deletion right flank: TCCTTCGCCGCTCCACCACCAAGACCAGGT. Validation: gk3124 passed by CGH.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037706 Copy   


  • RRID:WB-STRAIN:WBStrain00037704

http://www.wormbase.org/db/get?name=WBStrain00037704

Source Database: WormBase (WB)
Affected Genes: WBGene00000201(arx-3)|WBGene00001072(dpy-10)
Genomic Alteration: WBGene00000201(arx-3), WBGene00001072(dpy-10)
Availability: available
Source References: EMPTY
Synonyms: +/mT1 II; arx-3(ok1122)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC3166, CGC_VC3166
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y79H2A.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1122 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTTGGAAATCGTTTTGGCAT. External right primer: TTAAAACTCCGGCCAATCAG. Internal left primer: AACCACTTTTCCTCGTCCCT. Internal right primer: TTTTCGTGGCAAATTCCTTC. Internal WT amplicon: 2630 bp. Deletion size: 1688 bp. Deletion left flank: TTTTCCACCGATTTTTAATGTTTTCGATGT. Deletion right flank: GTTTTTGCGGTTAAGCCGGTCGAAATTGAA."

Proper citation: RRID:WB-STRAIN:WBStrain00037704 Copy   


  • RRID:WB-STRAIN:WBStrain00037709

http://www.wormbase.org/db/get?name=WBStrain00037709

Source Database: WormBase (WB)
Affected Genes: WBGene00004031(pis-1)
Genomic Alteration: WBGene00004031(pis-1)
Availability: available
Source References: EMPTY
Synonyms: pis-1(ok3720) IV.
Alternate IDs: WB-STRAIN:VC3179, CGC_VC3179
Notes: T13F2.3. Unc. External left primer: GCAAGCTTCTCGGTAAAACG. External right primer: GCCCAGCCAATATATTCCAA. Internal left primer: ATTGCTGATTTGGGGACATC. Internal right primer: TCTAATTTCCTGTCAGATTCAGG. Internal WT amplicon: 1277 bp. Deletion size: 588 bp. Deletion left flank: TGTAGTACCAGATGGGCCCGGCGGAGCAAA. Deletion right flank: GCTTGCCTTGCATACATTTGCTGCTGCCAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037709 Copy   


  • RRID:WB-STRAIN:WBStrain00037707

http://www.wormbase.org/db/get?name=WBStrain00037707

Source Database: WormBase (WB)
Affected Genes: WBGene00015065(B0228.8)
Genomic Alteration: WBGene00015065(B0228.8)
Availability: available
Source References: EMPTY
Synonyms: B0228.8(gk3093) II.
Alternate IDs: WB-STRAIN:VC3170, CGC_VC3170
Notes: B0228.8. External left primer: CATACATAGAGTGCCCAAGAGATG. External right primer: ATCGGTTTTTCAAATTTTGTCATT. Internal left primer: ATTTGTTTGCTTCGGAACAGAT. Internal right primer: TTTTTGGAGCTGTTTTGGAAAT. Internal WT amplicon: 1734 bp. Deletion size: 306 bp. Deletion left flank: CAACTTCTGCATAATAATTGCTCAAGAATG. Deletion right flank: CAATACTTATTGATAAGAAAAAGACAAATA. Validation: gk3093 passed by CGH.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037707 Copy   


  • RRID:WB-STRAIN:WBStrain00037708

http://www.wormbase.org/db/get?name=WBStrain00037708

Source Database: WormBase (WB)
Affected Genes: WBGene00011003(R04B5.5)
Genomic Alteration: WBGene00011003(R04B5.5)
Availability: available
Source References: EMPTY
Synonyms: R04B5.5(gk3064) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC3177, CGC_VC3177
Notes: Mutagen:UV/TMP|"R04B5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3064 homozygotes (mid- to late-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 894 bp. Deletion left flank: AATGGGACACCGAGTTCTTGTTCTCGGAGC. Deletion right flank: TATTAAAATGCCGAGAGGAAACATGATGTC. Insertion Sequence: AGGACCAATTGGAGTCTTGAATCTTCTTACTGCTAAAGCGATAGGTGCATCAAAAGTAG TAATCACTGATTTGAACGACGAGAGACTTGCTCTTGCACGCCTATTAGNAGCTGATGCT ACAATCAATGTTATGTAATAAAGAAGTT."|"R04B5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3064 homozygotes (mid- to late-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 894 bp. Deletion left flank: AATGGGACACCGAGTTCTTGTTCTCGGAGC. Deletion right flank: TATTAAAATGCCGAGAGGAAACATGATGTC. Insertion Sequence: AGGACCAATTGGAGTCTTGAATCTTCTTACTGCTAAAGCGATAGGTGCATCAAAAGTAGTAATCACTGATTTGAACGACGAGAGACTTGCTCTTGCACGCCTATTAGNAGCTGATGCTACAATCAATGTTATGTAATAAAGAAGTT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037708 Copy   


  • RRID:WB-STRAIN:WBStrain00037783

http://www.wormbase.org/db/get?name=WBStrain00037783

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00015203(cdk-11.1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00015203(cdk-11.1)
Availability: available
Source References: PMID:31519743
Synonyms: B0495.2(gk1202)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC3442, CGC_VC3442
Notes: B0495.2. Homozygous maternal-effect lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1202 homozygotes (viable F1s produce few F2s that arrest as early or mid-stage larvae). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATTATGAGCGACCACTTGGG. External right primer: CATTGAGGCAATTGAGAGCA. Internal left primer: GGACGACAGGAAAGATCTGG. Internal right primer: GGGTTTCACTTGCTCTGGTC. Internal WT amplicon: 2049 bp. Deletion size: 712 bp. Deletion left flank: GACAAATCGCCACACAAAAAGTCAAAACAT. Deletion right flank: GGAGAAAGAGAAAGAAGGATTTCCAATCAC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037783 Copy   


  • RRID:WB-STRAIN:WBStrain00037789

http://www.wormbase.org/db/get?name=WBStrain00037789

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00009562(flp-22)
Genomic Alteration: WBGene00000254(bli-4), WBGene00009562(flp-22)
Availability: available
Source References: EMPTY
Synonyms: flp-22(gk1201) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC3465, CGC_VC3465
Notes: F39H2.1. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1201 homozygotes (variable arrest, at least some animals persist to sterile adulthood). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGGTTTCCTTTTGAGCAG. External right primer: ATCCACTTGGGTTTCGTTTG. Internal left primer: TTCCGGAAACCGCATATTAG. Internal right primer: TTACGCAATGCACACACTGA. Internal WT amplicon: 2028 bp. Deletion size: 471 bp. Deletion left flank: TCAGCAAAATGGATGAGATTTGGAAAGCGT. Deletion right flank: TTTTTGAAGATCAAAGCGAAATAAGACATT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037789 Copy   


  • RRID:WB-STRAIN:WBStrain00037702

http://www.wormbase.org/db/get?name=WBStrain00037702

Source Database: WormBase (WB)
Affected Genes: WBGene00001032(dnj-14)|WBGene00003056(lon-2)|WBGene00018878(glit-1)
Genomic Alteration: WBGene00001032(dnj-14), WBGene00003056(lon-2), WBGene00018878(glit-1)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; dnj-14&glit-1(ok237)/szT1 X.
Alternate IDs: WB-STRAIN:VC3162, CGC_VC3162
Notes: F55D10.3, K02G10.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok237 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTGTTCGGTAAGCATTGGG. External right primer: AAAGTGTGTTCCGTCCTTGG. Internal left primer: CTGCCGTGGAATCTACCTGT. Internal right primer: GCAGTCGAACAACCACTTCA. Internal WT amplicon: 3216 bp. Deletion size: 2229 bp. Deletion left flank: TTTTGAGAAGGCGGTGGAGGCATGGCAATC. Deletion right flank: TTCGCTAAAAAATTGAGCCAATTTATTATT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037702 Copy   


  • RRID:WB-STRAIN:WBStrain00037788

http://www.wormbase.org/db/get?name=WBStrain00037788

Source Database: WormBase (WB)
Affected Genes: WBGene00000118(alh-12)|WBGene00000254(bli-4)
Genomic Alteration: WBGene00000118(alh-12), WBGene00000254(bli-4)
Availability: available
Source References: EMPTY
Synonyms: alh-12(gk3392) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC3462, CGC_VC3462
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y69F12A.2. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP heterozygotes, arrested hT2 aneuploids, and possibly non-GFP gk3392 homozygotes (if not Emb; undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.External left primer: CGGATCTGTCTGGTGGACTT. External right primer: GTTTCCAGCCGATACGACAT. Internal left primer: GCAACAGCGGATATTGTTGAT. Internal right primer: CAATTTTCACGTCCATGTCCT. Internal WT amplicon: 1413 bp. Deletion size: 709 bp. Deletion left flank: TCCAGGTGGACCATCTCAACGTATTGCCTA. Deletion right flank: ATTACTGGACTTTCCGATGAAGCTAGAGCT."

Proper citation: RRID:WB-STRAIN:WBStrain00037788 Copy   


  • RRID:WB-STRAIN:WBStrain00037790

http://www.wormbase.org/db/get?name=WBStrain00037790

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00004736(sca-1)|WBGene00194856(K11D9.5)
Genomic Alteration: WBGene00000254(bli-4), WBGene00004736(sca-1), WBGene00194856(K11D9.5)
Availability: available
Source References: EMPTY
Synonyms: sca-1&K11D9.5(gk3383) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC3468, CGC_VC3468
Notes: K11D9.2, K11D9.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3383 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGATGTTCTTCCATGGTGGC. External right primer: TCATGAGCTTCGCATTTACG. Internal left primer: AAGAACCACCACATTGAGGC. Internal right primer: AAGCGCTCAAGGAATACGAA. Internal WT amplicon: 2327 bp. Deletion size: 861 bp. Deletion left flank: CTTCAGATTGTTGCTCTGGTGGAAGATCGT. Deletion right flank: GTCCAGCGATGAACATCTTTGACACAGACA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037790 Copy   


  • RRID:WB-STRAIN:WBStrain00037791

http://www.wormbase.org/db/get?name=WBStrain00037791

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00016015(sna-3)
Genomic Alteration: WBGene00000254(bli-4), WBGene00016015(sna-3)
Availability: available
Source References: EMPTY
Synonyms: C23G10.8(gk3389) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC3472, CGC_VC3472
Notes: C23G10.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3389 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCATTGAATCTCCCGTGTCT. External right primer: ATACTCAGTCAACGGCCAGG. Internal left primer: TGCATTCGTTTATCCATCCA. Internal right primer: TGTTTGAACTGCTTTGCCTG. Internal WT amplicon: 1992 bp. Deletion size: 418 bp. Deletion left flank: TCAAGTTTCAGCGAATTAAAAAGCTTCTCA. Deletion right flank: GGCCATCCACTCCATGAACGTTTTATCGTT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037791 Copy   


  • RRID:WB-STRAIN:WBStrain00037717

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037717

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00008990(smgl-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008990(smgl-1)
Availability: available
Source References: EMPTY
Synonyms: smgl-1(ok2423) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC3196, CGC_VC3196
Notes: F20G4.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2423 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACCAATCCAGCTTTTC. External right primer: CCAAAACGAGAAGACGGAGA. Internal left primer: TTCGACTTTTTCGGCGAT. Internal right primer: ATGGAACATCCTGATGCTGA. Internal WT amplicon: 1173 bp. Deletion size: 637 bp. Deletion left flank: TTCTAAAAATAATTAAATTAGAGTGTTAAA. Deletion right flank: CGTATGGTTGCCACGTCGCGAGATCATGAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037717 Copy   


  • RRID:WB-STRAIN:WBStrain00037714

http://www.wormbase.org/db/get?name=WBStrain00037714

Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)|WBGene00021754(hpo-29)
Genomic Alteration: WBGene00001063(dpy-1), WBGene00021754(hpo-29)
Availability: available
Source References: EMPTY
Synonyms: Y50D7A.4(gk3089)/sC1 [dpy-1(s2170)] III.
Alternate IDs: WB-STRAIN:VC3192, CGC_VC3192
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y50D7A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3089 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTATCCGAATTTTCTGCGG. External right primer: ATTTTCAACGGAATTCGACG. Internal left primer: GAAAATTTTGCATTTTCAAGGC. Internal right primer: TCCGCGATTTTTATAGCATTTT. Internal WT amplicon: 940 bp. Deletion size: 647 bp. Deletion left flank: TTTTGTCAAGCCTCAAATCCCACAATTTTG. Deletion right flank: ATAAATGAGCCAAAATTCGTCAAATTCTGT."

Proper citation: RRID:WB-STRAIN:WBStrain00037714 Copy   


  • RRID:WB-STRAIN:WBStrain00037718

http://www.wormbase.org/db/get?name=WBStrain00037718

Source Database: WormBase (WB)
Affected Genes: WBGene00011735(hip-1)
Genomic Alteration: WBGene00011735(hip-1)
Availability: available
Source References: EMPTY
Synonyms: hip-1(gk3264) III.
Alternate IDs: WB-STRAIN:VC3198, CGC_VC3198
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T12D8.8. External left primer: GCTGCAGGAATCACTGACAA. External right primer: GAGACGCGAGGAAGAACAAC. Internal left primer: TGGGTCTTCCACCAAAGAAG. Internal right primer: GCGCAAATGCACAGAATATG. Internal WT amplicon: 1339 bp. Deletion size: 689 bp. Deletion left flank: AGCCTTGTGCCGAGTCTGGGTTGATAGAGA. Deletion right flank: GAATTGAAGTGTTTATTCAATTTGTTTGGA. Validation: gk3264 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037718 Copy   


  • RRID:WB-STRAIN:WBStrain00037719

http://www.wormbase.org/db/get?name=WBStrain00037719

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006552(tbx-33)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006552(tbx-33)
Availability: available
Source References: EMPTY
Synonyms: tbx-33(gk3098) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC3199, CGC_VC3199
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y66A7A.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3098 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATATTGAAAACTAGGAACTTGGCG. External right primer: CCTACCAGAATCAGTATGCACATC. Internal left primer: CTGAATTTGTTCCATTGTTAGAAAGA. Internal right primer: CTTAAAGTCAAAAACAAACGTTCAAA. Internal WT amplicon: 1543 bp. Deletion size: 474 bp. Deletion left flank: AGGATTAGGCATAGGTTTAGGCTTAGGGTT. Deletion right flank: TTGTAGTTGGATTCTGGATTGAGATGCTCG. Insertion Sequence: GGGCTTAGGATAAAGCTTTGGCTCACGCTTAGGTTTAGGATTAGGTATAGGTTTAGGCT TAGGGTTAGGCTTAGGGTTAGGCTTAGGC."|"Y66A7A.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3098 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATATTGAAAACTAGGAACTTGGCG. External right primer: CCTACCAGAATCAGTATGCACATC. Internal left primer: CTGAATTTGTTCCATTGTTAGAAAGA. Internal right primer: CTTAAAGTCAAAAACAAACGTTCAAA. Internal WT amplicon: 1543 bp. Deletion size: 474 bp. Deletion left flank: AGGATTAGGCATAGGTTTAGGCTTAGGGTT. Deletion right flank: TTGTAGTTGGATTCTGGATTGAGATGCTCG. Insertion Sequence: GGGCTTAGGATAAAGCTTTGGCTCACGCTTAGGTTTAGGATTAGGTATAGGTTTAGGCTTAGGGTTAGGCTTAGGGTTAGGCTTAGGC."

Proper citation: RRID:WB-STRAIN:WBStrain00037719 Copy   


  • RRID:WB-STRAIN:WBStrain00037798

http://www.wormbase.org/db/get?name=WBStrain00037798

Source Database: WormBase (WB)
Affected Genes: WBGene00003544(nas-25)
Genomic Alteration: WBGene00003544(nas-25)
Availability: available
Source References: EMPTY
Synonyms: nas-25(ok3756) II.
Alternate IDs: WB-STRAIN:VC3556, CGC_VC3556
Notes: F46C5.3. External left primer: GGATCATGCTCATCTCCGAT. External right primer: CGGTTTCTTGCTTCATCCTC. Internal left primer: GACGCCAACAAATTGGAACT. Internal right primer: ATTTGAAACAAAGAAGGCGG. Internal WT amplicon: 1158 bp. Deletion size: 651 bp. Deletion left flank: AAGTGTTATGCATTATTCAGCTGATTCGTA. Deletion right flank: CTCCATTAAATCTAACAACTACTGTTAATC.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037798 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X