Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037701
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00015297(sco-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00015297(sco-1)
Availability: available
Source References: EMPTY
Synonyms: sco-1(ok3770)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC3153, CGC_VC3153
Notes: C01F1.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3770 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCGATGATGTGCGAATTTGT. External right primer: CAATCGAACGCCTTGAAAAT. Internal left primer: CAAATCCATGATTTTCACTCCA. Internal right primer: AAGCTGAGCAATGGTTTTCTTT. Internal WT amplicon: 1241 bp. Deletion size: 653 bp. Deletion left flank: GGACGCTGGCATCAGCCGCACGGTTTTCAG. Deletion right flank: GGAACCACAGAGCAAGTTAATAAAGTTGCG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037701 Copy
http://www.wormbase.org/db/get?name=WBStrain00037669
Source Database: WormBase (WB)
Affected Genes: WBGene00008996(glb-14)
Genomic Alteration: WBGene00008996(glb-14)
Availability: available
Source References: EMPTY
Synonyms: glb-14(ok3757) V.
Alternate IDs: WB-STRAIN:VC3093, CGC_VC3093
Notes: F21A3.6. External left primer: CAAATTGGCGAACTTCATCC. External right primer: AAATCCGTGATTTTTCGCAC. Internal left primer: CAAGCCTGTTTATAGACTTTTGGG. Internal right primer: AATTCCACTTTCCGAGCAGA. Internal WT amplicon: 1231 bp. Deletion size: 542 bp. Deletion left flank: ATACTGATGAATAATGCGTATCTAATAACT. Deletion right flank: CTGCAAGGCACGGCAGGCATTTTTGCGCCT. Insertion Sequence: GCAAGG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037669 Copy
http://www.wormbase.org/db/get?name=WBStrain00037666
Source Database: WormBase (WB)
Affected Genes: WBGene00022127(yop-1)
Genomic Alteration: WBGene00022127(yop-1)
Availability: available
Source References: EMPTY
Synonyms: yop-1(ok3629) I.
Alternate IDs: WB-STRAIN:VC3086, CGC_VC3086
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y71F9B.3. External left primer: AGCCCTGACTGGTTCACATC. External right primer: AAAAAGGGAATTTTGGTGGG. Internal left primer: GCAAAAGGTCTTGGACGATG. Internal right primer: TCATTCCATGTGATCTCGGA. Internal WT amplicon: 1215 bp. Deletion size: 860 bp. Deletion left flank: AGCGGCTTCATTTGGTGCTCGGCGTCGTCG. Deletion right flank: TTCTCCGTTCAAATCGTCGCCGTTTTCCCA."
Proper citation: RRID:WB-STRAIN:WBStrain00037666 Copy
http://www.wormbase.org/db/get?name=WBStrain00037667
Source Database: WormBase (WB)
Affected Genes: WBGene00019827(mop-25.1)
Genomic Alteration: WBGene00019827(mop-25.1)
Availability: available
Source References: EMPTY
Synonyms: mop-25.1(ok3762) X.
Alternate IDs: WB-STRAIN:VC3090, CGC_VC3090
Notes: Made_by: Vancouver KO Group|"R02E12.2. External left primer: TTTTGGGCGTTTTTCTTACG. External right primer: ACAGAAGCTGTTGCCGAGTT. Internal left primer: GGAAATTTTGAACGACCACAG. Internal right primer: GAGTTGTTTTACAGGAATTCTCCA. Internal WT amplicon: 1136 bp. Deletion size: 392 bp. Deletion left flank: TTTCAAATATTCCATGACCACCCAAAAAAA. Deletion right flank: CATCCGCACAAGCTGTCTTCATCGTACTGT. Insertion Sequence: ATCTCGCATA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037667 Copy
http://www.wormbase.org/db/get?name=WBStrain00037672
Source Database: WormBase (WB)
Affected Genes: WBGene00018187(twf-2)
Genomic Alteration: WBGene00018187(twf-2)
Availability: available
Source References: EMPTY
Synonyms: F38E9.5(gk3181) X.
Alternate IDs: WB-STRAIN:VC3103, CGC_VC3103
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3181) in F38E9.5, detectable by PCR using the following primers. External left primer: GAGCAGCCAAAGGCTCATAC. External right primer: GGCTAGTCTCGGACTGGTTG. Internal left primer: GTGCTTCATTCTGTTCCGGT. Internal right primer: TTCCAATGATTCGAGGGTTC. Internal WT amplicon: 1591 bp. Deletion size: approximately 500 bp. Validation: gk3181 passed by CGH. Deleted probe: GAAGAAAGCATTTAGAAGTTATAGCTTTGGACTAGCATCCGTTTTAAAAT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037672 Copy
http://www.wormbase.org/db/get?name=WBStrain00037675
Source Database: WormBase (WB)
Affected Genes: WBGene00012988(ztf-22)
Genomic Alteration: WBGene00012988(ztf-22)
Availability: available
Source References: EMPTY
Synonyms: ztf-22(gk3235) II.
Alternate IDs: WB-STRAIN:VC3110, CGC_VC3110
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 369 bp. Deletion left flank: TTTGGAGCAACGTGTTTAAAGTGTTGAAGA. Deletion right flank: GGTTGGCAAGTGTTAAAATGTCCAAATATC. Validation: gk3235 passed by CGH."
Proper citation: RRID:WB-STRAIN:WBStrain00037675 Copy
http://www.wormbase.org/db/get?name=WBStrain00037676
Source Database: WormBase (WB)
Affected Genes: WBGene00001680(gpb-2)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00001680(gpb-2), WBGene00003056(lon-2)
Availability: available
Source References: EMPTY
Synonyms: gpb-2(ok3691)/szT1 [lon-2(e678)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:VC3111, CGC_VC3111
Notes: F52A8.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3691 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATAATCAAGCCCAAATGCG. External right primer: CCAACAACTTGGGTTATGGC. Internal left primer: TTCCATCAGGAGAAGTTCGG. Internal right primer: ATCGCTTGCGGGTAAGATTT. Internal WT amplicon: 1318 bp. Deletion size: 393 bp. Deletion left flank: TTGTCACTTCTTCTCGAGGAGTACACTAGC. Deletion right flank: ACATGTTGAATCTCCACTTCCAGTTAAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037676 Copy
http://www.wormbase.org/db/get?name=WBStrain00037673
Source Database: WormBase (WB)
Affected Genes: WBGene00000779(cpn-3)
Genomic Alteration: WBGene00000779(cpn-3)
Availability: available
Source References: EMPTY
Synonyms: cpn-3(ok3766) I.
Alternate IDs: WB-STRAIN:VC3106, CGC_VC3106
Notes: F28H1.2. External left primer: TTTTTAAGTCCGGCAAATGG. External right primer: ATGTTTTTGCTGTGAAGCCC. Internal left primer: AGGCGCACACTATTTTTCGT. Internal right primer: CCGGCGTATAGAAACCAGAG. Internal WT amplicon: 1306 bp. Deletion size: 543 bp. Deletion left flank: GATCAAGAAGCTCTCCGGTGAGAACATCTC. Deletion right flank: ACAAAGCTCGATTCTTCTCTCTTTTCTGCC.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037673 Copy
http://www.wormbase.org/db/get?name=WBStrain00037674
Source Database: WormBase (WB)
Affected Genes: WBGene00020284(mel-46)
Genomic Alteration: WBGene00020284(mel-46)
Availability: available
Source References: EMPTY
Synonyms: mel-46(ok3760) IV.
Alternate IDs: WB-STRAIN:VC3108, CGC_VC3108
Notes: Made_by: Vancouver KO Group|"T06A10.1. External left primer: CAGCTTGTCTCCCGAATCTC. External right primer: AGGCCAACAATAGCCAAAAA. Internal left primer: CTCGTCTTTCTCGCGTTTTC. Internal right primer: TTTGAGCAATTCTGGACTAAAAA. Internal WT amplicon: 1270 bp. Deletion size: 448 bp. Deletion left flank: GACGTGAAGGCTTCACGAATGTGTTGGAGC. Deletion right flank: ACAGAAAAATGGGCGGGGCACAGTTTTGCA. Insertion Sequence: AGAAAAAT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037674 Copy
http://www.wormbase.org/db/get?name=WBStrain00037677
Source Database: WormBase (WB)
Affected Genes: WBGene00016558(pks-1)
Genomic Alteration: WBGene00016558(pks-1)
Availability: available
Source References: EMPTY
Synonyms: C41A3.1(ok3769) X.
Alternate IDs: WB-STRAIN:VC3112, CGC_VC3112
Notes: C41A3.1. External left primer: AAGCTTGGCGATCAGGTAGA. External right primer: CAGTTGACTCAATTTCCGCA. Internal left primer: ACGGCATAATACCGAACCAG. Internal right primer: TGCTCGTCAACAATGTTCGT. Internal WT amplicon: 1141 bp. Deletion size: 689 bp. Deletion left flank: CTCAATCCGACTCTGCGATGGAGGATATTT. Deletion right flank: GATCTGCCAGCTATTTGCTTGTGGGTTTGA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037677 Copy
http://www.wormbase.org/db/get?name=WBStrain00037683
Source Database: WormBase (WB)
Affected Genes: WBGene00006815(unc-83)|WBGene00011581(T07D10.1)|WBGene00013786(nep-24)|WBGene00019119(F59E12.3)
Genomic Alteration: WBGene00006815(unc-83), WBGene00011581(T07D10.1), WBGene00013786(nep-24), WBGene00019119(F59E12.3)
Availability: available
Source References: EMPTY
Synonyms: T07D10.1(gk3249) I; F59E12.3(gk3183) II; Y116A8C.5(gk3250) IV; unc-83(gk3251) gkDf35 V; gkDf32 X.
Alternate IDs: WB-STRAIN:VC3121, CGC_VC3121
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037683 Copy
http://www.wormbase.org/db/get?name=WBStrain00037681
Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00010870(let-522)
Genomic Alteration: WBGene00003056(lon-2), WBGene00010870(let-522)
Availability: available
Source References: EMPTY
Synonyms: M05B5.2(ok3716)/szT1 [lon-2(e678)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:VC3118, CGC_VC3118
Notes: M05B5.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3716 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGCAGTTTCAGGGTTCAAA. External right primer: CTAAGGCACTTGGCTTTTGC. Internal left primer: GGGAGGAAATTTCAAAAATGA. Internal right primer: AAAAATTTAACGCGTCGCTG. Internal WT amplicon: 1169 bp. Deletion size: 569 bp. Deletion left flank: GGAATGGCAAATTGACAGCATGAGGGTTTC. Deletion right flank: TTTTTGGGATGTTCAGCGACGCGTTAAATT. Insertion Sequence: TTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037681 Copy
http://www.wormbase.org/db/get?name=WBStrain00037648
Source Database: WormBase (WB)
Affected Genes: WBGene00009925(F52B11.2)
Genomic Alteration: WBGene00009925(F52B11.2)
Availability: available
Source References: EMPTY
Synonyms: F52B11.2(ok3718) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC3054, CGC_VC3054
Notes: F52B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3718 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCTGAAATATGGCGGAGA. External right primer: TCTTCTGGCCCTTCAACAGT. Internal left primer: ACACGAAGCACTGGCTTTTT. Internal right primer: GTCCGACAGTCCGTTCGT. Internal WT amplicon: 1267 bp. Deletion size: 518 bp. Deletion left flank: AATGTATTATTTTCCATTTTCCGAATTTTT. Deletion right flank: CGGATTCAAGGGCACCGAACCGTATCCAGT. Insertion Sequence: TT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037648 Copy
http://www.wormbase.org/db/get?name=WBStrain00037642
Source Database: WormBase (WB)
Affected Genes: WBGene00007357(C06A12.3)
Genomic Alteration: WBGene00007357(C06A12.3)
Availability: available
Source References: EMPTY
Synonyms: C06A12.3(ok3746) IV.
Alternate IDs: WB-STRAIN:VC3042, CGC_VC3042
Notes: C06A12.3. External left primer: CAATGCAACGCCAATTGTTA. External right primer: CTCATCAATGCCTTGCTCCT. Internal left primer: TCCATTGTTTGAAGAGTGCTG. Internal right primer: CGAATTGGCTAAAAACTCGAA. Internal WT amplicon: 1192 bp. Deletion size: 336 bp. Deletion left flank: TATGTTCCATTGTTTGAAGAGTGCTGTTCT. Deletion right flank: TGAATAGAAAACGTCACGAAGTGGTGAGTT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037642 Copy
http://www.wormbase.org/db/get?name=WBStrain00037641
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: F48C1.4(ok3745) I.
Alternate IDs: WB-STRAIN:VC3041, CGC_VC3041
Notes: F48C1.4. External left primer: AACGATAGGAGACACGGTGG. External right primer: TGTGGTTGTTTTCGTTGCAT. Internal left primer: CAAGTTGAGAGTCCGCAGTG. Internal right primer: ACCATAAACTTGTTCGCGCT. Internal WT amplicon: 1143 bp. Deletion size: 523 bp. Deletion left flank: TTAGACAACTAACCATAGAGCGTGCAAATC. Deletion right flank: TGTTTCAGTGTTCTCCTTCCTGAAAAAAAA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037641 Copy
http://www.wormbase.org/db/get?name=WBStrain00037646
Source Database: WormBase (WB)
Affected Genes: WBGene00000120(aly-1)
Genomic Alteration: WBGene00000120(aly-1)
Availability: available
Source References: EMPTY
Synonyms: aly-1(ok3754) IV.
Alternate IDs: WB-STRAIN:VC3046, CGC_VC3046
Notes: C01F6.5. External left primer: CAACTCCCCCAAATTGGTAA. External right primer: GACGAAGGGATGATATGGGA. Internal left primer: TTTTTGATGTCACCTACCTATTCTA. Internal right primer: TTTGTTCGCCGTTCAATATG. Internal WT amplicon: 1251 bp. Deletion size: 617 bp. Deletion left flank: TCTCCAGATACTCCATCCACCTAGTCTATC. Deletion right flank: CGTGAACTTCAACGAGCACGGAAAACCAGT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037646 Copy
http://www.wormbase.org/db/get?name=WBStrain00037647
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001840(hel-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001840(hel-1)
Availability: available
Source References: EMPTY
Synonyms: hel-1(ok3698)/mT1 II; +/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC3049, CGC_VC3049
Notes: C26D10.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAACCAAGTTCTGGCCATCT. External right primer: TTCCATTCTCCTTCCACCTG. Internal left primer: GGCGGAGAACATCATCACTT. Internal right primer: TTTCGGATCGTTTCGCTACT. Internal WT amplicon: 1141 bp. Deletion size: 721 bp. Deletion left flank: TGTCGCACTCGTCCAGGACGAAGTACTTGA. Deletion right flank: GAAATTTAGTAAATAACCTCACAAAAACAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037647 Copy
http://www.wormbase.org/db/get?name=WBStrain00037659
Source Database: WormBase (WB)
Affected Genes: WBGene00006629(tsp-3)
Genomic Alteration: WBGene00006629(tsp-3)
Availability: available
Source References: EMPTY
Synonyms: tsp-3(ok3729) III.
Alternate IDs: WB-STRAIN:VC3075, CGC_VC3075
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y39E4B.4. External left primer: AAACCGCATTTGTCCGAATA. External right primer: TGCCCCCACTAACCAATATC. Internal left primer: TGTCTTAAAGCAAACGTGCAA. Internal right primer: ACTACTGCCGGCTCTATCGG. Internal WT amplicon: 1181 bp. Deletion size: 351 bp. Deletion left flank: GTTTTGATAAAGGCTTCGAATCGGAAATTC. Deletion right flank: AGGCTCCATACTTTCTGTTTATGGTTATCT."
Proper citation: RRID:WB-STRAIN:WBStrain00037659 Copy
http://www.wormbase.org/db/get?name=WBStrain00037654
Source Database: WormBase (WB)
Affected Genes: WBGene00009132(F25H8.2)
Genomic Alteration: WBGene00009132(F25H8.2)
Availability: available
Source References: EMPTY
Synonyms: F25H8.2(ok3636) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC3062, CGC_VC3062
Notes: F25H8.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3636 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGCAAACATGCTCCAATGA. External right primer: ATTATCCGATCTGGCAGGTG. Internal left primer: AACAAACGACACTCCGATTTC. Internal right primer: ATCTCGTTTTCGCCCTCTGT. Internal WT amplicon: 1333 bp. Deletion size: 333 bp. Deletion left flank: GAATGATTAGATTTCTAGCGTAATGTTCAC. Deletion right flank: AGAAGTTTTATAGGCATCGATGATACCCAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037654 Copy
http://www.wormbase.org/db/get?name=WBStrain00037651
Source Database: WormBase (WB)
Affected Genes: WBGene00022645(irg-8)
Genomic Alteration: WBGene00022645(irg-8)
Availability: available
Source References: PMID:32009302, PMID:32560629
Synonyms: irg-8(ok3738) V.
Alternate IDs: WB-STRAIN:VC3059, CGC_VC3059
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK6.11. External left primer: ATCAGTCATAAGGCGATGGG. External right primer: CCATTTCAATAAACCGGTCG. Internal left primer: AAGGCTTCAAGGCTGTCAGA. Internal right primer: GTGGCTCGGTTTCACACTTT. Internal WT amplicon: 1209 bp. Deletion size: 496 bp. Deletion left flank: CAGCGTACAGATATGCCAGAGCAGTAGAGT. Deletion right flank: TAAATATTATACGGCGGGTAAACTTTAAAA."
Proper citation: RRID:WB-STRAIN:WBStrain00037651 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.