Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 165 showing 3281 ~ 3300 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00037410

http://www.wormbase.org/db/get?name=WBStrain00037410

Source Database: WormBase (WB)
Affected Genes: WBGene00011195(sao-1)
Genomic Alteration: WBGene00011195(sao-1)
Availability: available
Source References: EMPTY
Synonyms: sao-1(ok3281) V.
Alternate IDs: WB-STRAIN:VC2564, CGC_VC2564
Notes: Made_by: Vancouver KO Group|"R10D12.14. External left primer: AAGAGCGAGATGACGAGGAA. External right primer: ACCATTTGTCCGAGCAACTC. Internal left primer: GACATCAAAATACCGACGGC. Internal right primer: GAACACGAGAAGCCTGTTCC. Internal WT amplicon: 1196 bp. Deletion size: 595 bp. Deletion left flank: TCCAATGCCGCTTCTCCATCAAATGAATCA. Deletion right flank: ATGATTTTAAAATAGTTTCAGATTTCAAAG."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037410 Copy   


  • RRID:WB-STRAIN:WBStrain00037415

http://www.wormbase.org/db/get?name=WBStrain00037415

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Y92H12A.2 (ok3321) I.
Alternate IDs: WB-STRAIN:VC2570, CGC_VC2570
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y92H12A.2. External left primer: AAATACAATGCTCTCGCGCT. External right primer: GTAAGCGGCAAACGATTTTT. Internal left primer: TCTACGGGTCCGTCTATTGC. Internal right primer: ACTTCGAAACACTTTCCGGC. Internal WT amplicon: 1132 bp. Deletion size: 538 bp. Deletion left flank: AAAATTACAAGCTTTTAGAGGAAAAATTGA. Deletion right flank: GATTGTCTTATTTTGGCTTGATCTACGTTG."

Proper citation: RRID:WB-STRAIN:WBStrain00037415 Copy   


  • RRID:WB-STRAIN:WBStrain00037416

http://www.wormbase.org/db/get?name=WBStrain00037416

Source Database: WormBase (WB)
Affected Genes: WBGene00019408(K05F1.6)
Genomic Alteration: WBGene00019408(K05F1.6)
Availability: available
Source References: EMPTY
Synonyms: K05F1.6(ok3328) II.
Alternate IDs: WB-STRAIN:VC2571, CGC_VC2571
Notes: K05F1.6. External left primer: ATCAATGCTCGGAGTGTTCC. External right primer: TCCGGTAGTGGCTTCTCACT. Internal left primer: TGTGCATGGAAATCACAGGT. Internal right primer: TTCTGGTAATACGAACACCAACA. Internal WT amplicon: 1188 bp. Deletion size: 472 bp. Deletion left flank: CTTCATGTCAATCATATTTATTTGTTCAAT. Deletion right flank: GGAGCAATTGAAATTCCAACATTGTTTGCG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037416 Copy   


  • RRID:WB-STRAIN:WBStrain00037413

http://www.wormbase.org/db/get?name=WBStrain00037413

Source Database: WormBase (WB)
Affected Genes: WBGene00011100(nhr-209)
Genomic Alteration: WBGene00011100(nhr-209)
Availability: available
Source References: EMPTY
Synonyms: nhr-209(gk1135) V.
Alternate IDs: WB-STRAIN:VC2567, CGC_VC2567
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"R07B7.16. External left primer: ATGGTGCATTGATGGTCAGA. External right primer: GCGGAAAACTCCAAACGATA. Internal left primer: CTTCCTGAATCAGCACAGCA. Internal right primer: GGCCCGTCTTGTTAACTTCA. Internal WT amplicon: 2735 bp. Deletion size: 1749 bp. Deletion left flank: TACTGTGAATATTGAACTGATCCATGAAAT. Deletion right flank: ATAGAGTTTCAGCTGTCCCTGGTCTCACAT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037413 Copy   


  • RRID:WB-STRAIN:WBStrain00037507

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037507

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006958(wve-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006958(wve-1)
Availability: available
Source References: PMID:38190406
Synonyms: wve-1(ok3308) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2706, CGC_VC2706
Notes: R06C1.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3308 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAGCTGGGACTTCGTTG. External right primer: TTTTGGCTGCTCGCTTTTAT. Internal left primer: GGGTTTCTAGCGATTTTTCCA. Internal right primer: ACGATTTTCGTGCCAATTTC. Internal WT amplicon: 1322 bp. Deletion size: 556 bp. Deletion left flank: TTGGCCTGCTCGGGGAGCACAAGAGCTGTG. Deletion right flank: CTGTAGGTAAAGTGCTTCTATCCAGAATAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037507 Copy   


  • RRID:WB-STRAIN:WBStrain00037508

http://www.wormbase.org/db/get?name=WBStrain00037508

Source Database: WormBase (WB)
Affected Genes: WBGene00001250(elt-2)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00001250(elt-2), WBGene00003056(lon-2)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; elt-2(ok3382)/szT1 X.
Alternate IDs: WB-STRAIN:VC2708, CGC_VC2708
Notes: C33D3.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3382 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCATGCAACCGTTTTATCCT. External right primer: TTGGGAAAAGCAACTCAACC. Internal left primer: CTCTTGGAACTTTTTCGGGA. Internal right primer: ATAAGCGAGGAAGTGGCAAA. Internal WT amplicon: 1306 bp. Deletion size: 1171 bp. Deletion left flank: TGGAACTTTTTCGGGATATACAAACTCGTA. Deletion right flank: GTTCCAAACGATCAAAACTACGTGTATGCA. Insertion Sequence: CCAAACGATCAAAACTC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037508 Copy   


  • RRID:WB-STRAIN:WBStrain00037505

http://www.wormbase.org/db/get?name=WBStrain00037505

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00009246(gfm-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00009246(gfm-1)
Availability: available
Source References: EMPTY
Synonyms: F29C12.4(ok3372)/mT1 II; +/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2701, CGC_VC2701
Notes: F29C12.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3372 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACGAACGGAAAACAACG. External right primer: GTGCATTTTTATTCCCGCAT. Internal left primer: CGCGTACTCCTCTCGGATAA. Internal right primer: TGGGACATATTAGCACCACG. Internal WT amplicon: 1208 bp. Deletion size: 371 bp. Deletion left flank: TTATTTTTAAATTATTTTAATAGTTTTTTT. Deletion right flank: ATTATTGATACACCAGGCCACGTGGATTTC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037505 Copy   


  • RRID:WB-STRAIN:WBStrain00037506

http://www.wormbase.org/db/get?name=WBStrain00037506

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00021460(zwl-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00021460(zwl-1)
Availability: available
Source References: PMID:33713117
Synonyms: zwl-1(ok2378) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2705, CGC_VC2705
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y39G10AR.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2378 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGCGAAAACAAAACAATTT. External right primer: TGAGGAAATTTCGGCTCATT. Internal left primer: TTTCCCAGAAAATGCCACTC. Internal right primer: GCAACTCTGGCATGCTTTTT. Internal WT amplicon: 2881 bp. Deletion size: 2093 bp. Deletion left flank: CAGCGGTTGTGACAAAGAAAAGTGTGCGAA. Deletion right flank: TTGCAACGGAGAATCGACCGGCTCCTGGCG."

Proper citation: RRID:WB-STRAIN:WBStrain00037506 Copy   


  • RRID:WB-STRAIN:WBStrain00037509

http://www.wormbase.org/db/get?name=WBStrain00037509

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00022458(prp-31)
Genomic Alteration: WBGene00000254(bli-4), WBGene00022458(prp-31)
Availability: available
Source References: EMPTY
Synonyms: Y110A7A.8(gk1094) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2709, CGC_VC2709
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y110A7A.8. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1094 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk1094/hT2[qIs48] but is gk1094/hT2.) External left primer: TTTCATTCTCTTCGCGACCT. External right primer: CACACTCCAGCACTGGAAAA. Internal left primer: TGCAGCAATGAAGAGAAACG. Internal right primer: TTTCGCATATGGGTCGAAAT. Internal WT amplicon: 2229 bp. Deletion size: 1953 bp. Deletion left flank: AGCGAACTGCAGCAATGAAGAGAAACGAGA. Deletion right flank: ATATATTTATTTGTTACTTTCCTCTTCCTG. Insertion Sequence: GAACG."

Proper citation: RRID:WB-STRAIN:WBStrain00037509 Copy   


  • RRID:WB-STRAIN:WBStrain00037587

http://www.wormbase.org/db/get?name=WBStrain00037587

Source Database: WormBase (WB)
Affected Genes: WBGene00016557(ceh-84)|WBGene00022412(Y102A11A.2)
Genomic Alteration: WBGene00016557(ceh-84), WBGene00022412(Y102A11A.2)
Availability: available
Source References: EMPTY
Synonyms: C40D2.4(gk1252) II; Y102A11A.2(gk3151) X.
Alternate IDs: WB-STRAIN:VC2914, CGC_VC2914
Notes: C40D2.4, Y102A11A.2. The gk1252 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 547 bp. Deletion left flank: AAATTGCAATCGCTTCCGGTAAAATTACTT. Deletion right flank: GTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATA TGTATATGTATATGTATATGTATATGTATATGTATATGTTTATGTATATGTATATGTAT ATGTAAATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTA TATGTATATGTATATGTATATGCTGAAAGTCGA. The gk3151 allele was identifed by CGH.|"C40D2.4, Y102A11A.2. The gk1252 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 547 bp. Deletion left flank: AAATTGCAATCGCTTCCGGTAAAATTACTT. Deletion right flank: GTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTTTATGTATATGTATATGTATATGTAAATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGCTGAAAGTCGA. The gk3151 allele was identifed by CGH."|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037587 Copy   


  • RRID:WB-STRAIN:WBStrain00037588

http://www.wormbase.org/db/get?name=WBStrain00037588

Source Database: WormBase (WB)
Affected Genes: WBGene00077521(maf-1)
Genomic Alteration: WBGene00077521(maf-1)
Availability: available
Source References: EMPTY
Synonyms: F45H11.6(gk1242) I.
Alternate IDs: WB-STRAIN:VC2916, CGC_VC2916
Notes: F45H11.6. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 572 bp. Deletion left flank: GAAATATTTGAAGTAAAAATAATAATACAT. Deletion right flank: TTGAATGCCAGTTTTAAGGCACACACTGCT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037588 Copy   


  • RRID:WB-STRAIN:WBStrain00037585

http://www.wormbase.org/db/get?name=WBStrain00037585

Source Database: WormBase (WB)
Affected Genes: WBGene00018679(F52C12.2)|WBGene00138717(F52C12.6)
Genomic Alteration: WBGene00018679(F52C12.2), WBGene00138717(F52C12.6)
Availability: available
Source References: EMPTY
Synonyms: F52C12.2&F52C12.6(gk3019) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2901, CGC_VC2901
Notes: F52C12.2, F52C12.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3019 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTCTATTTTTCCCCCGAAG. External right primer: TTGCATCTTGCGGTAGACAG. Internal left primer: TTCGGAGCTTCGTTGTTTCT. Internal right primer: ATCCCGTCTCAATTGTCGTC. Internal WT amplicon: 3351 bp. Deletion size: 2297 bp. Deletion left flank: AATTTTAAAATTTTAATTCCTTGTGGCAAA. Deletion right flank: CGACTCGGAAGGCGAAATGGATTTTGAGAC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037585 Copy   


  • RRID:WB-STRAIN:WBStrain00037504

http://www.wormbase.org/db/get?name=WBStrain00037504

Source Database: WormBase (WB)
Affected Genes: WBGene00004458(rpn-1)
Genomic Alteration: WBGene00004458(rpn-1)
Availability: available
Source References: EMPTY
Synonyms: rpn-1(ok2205) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2699, CGC_VC2699
Notes: T22D1.9. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2205 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTTGACCAACACGAACAGA. External right primer: TGACTGCGCCTTTAAACAAA. Internal left primer: TCAAGCTTCCAGGCTTCATT. Internal right primer: TGGTGGCGACTACTCAACAG. Internal WT amplicon: 2938 bp. Deletion size: 1651 bp. Deletion left flank: TATGAACAAGGGAATAGCCAAAACTCGAGG. Deletion right flank: ATGGCTTGTAAAGTGTTGTGTCCGGTTCAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037504 Copy   


  • RRID:WB-STRAIN:WBStrain00037502

http://www.wormbase.org/db/get?name=WBStrain00037502

Source Database: WormBase (WB)
Affected Genes: WBGene00016673(ttbk-6)
Genomic Alteration: WBGene00016673(ttbk-6)
Availability: available
Source References: EMPTY
Synonyms: C45G9.1(gk1235) III.
Alternate IDs: WB-STRAIN:VC2697, CGC_VC2697
Notes: C45G9.1. External left primer: GAAGGCCGAATCAAATGAAA. External right primer: AAACTGCGAGAAAATCCGAA. Internal left primer: CCTTTGCGCGTAAGATATGG. Internal right primer: ATCAATTAGGCTTCGGGCTT. Internal WT amplicon: 1743 bp. Deletion size: 1228 bp. Deletion left flank: TCTCCTATATGGTCATGACGTTATTGGGGA. Deletion right flank: TCTTATGGAAAACAAAATTTAATATTCTAT. Insertion Sequence: TGGAAAAAA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037502 Copy   


  • RRID:WB-STRAIN:WBStrain00037594

http://www.wormbase.org/db/get?name=WBStrain00037594

Source Database: WormBase (WB)
Affected Genes: WBGene00016866(coel-1)
Genomic Alteration: WBGene00016866(coel-1)
Availability: available
Source References: EMPTY
Synonyms: coel-1(gk1284) X.
Alternate IDs: WB-STRAIN:VC2931, CGC_VC2931
Notes: C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 182 bp. Deletion left flank: ATCATACCGAACTGCGGTCCTGCTGCCTGT. Deletion right flank: GCCAGAGAGCCCTAGAACTTCTTGTGCTGA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037594 Copy   


  • RRID:WB-STRAIN:WBStrain00037593

http://www.wormbase.org/db/get?name=WBStrain00037593

Source Database: WormBase (WB)
Affected Genes: WBGene00005699(sru-36)|WBGene00016557(ceh-84)
Genomic Alteration: WBGene00005699(sru-36), WBGene00016557(ceh-84)
Availability: available
Source References: EMPTY
Synonyms: C40D2.4(gk1258) II; sru-36(gk3145) V.
Alternate IDs: WB-STRAIN:VC2930, CGC_VC2930
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"R07B5.6, C40D2.4. The gk1258 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 942 bp. Deletion left flank: ATGAGTGATTTACTTTTAAAACTTGAAAAT. Deletion right flank: ATATGTATATGTATATGTATATGTATATGT. The gk3145 allele was identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037593 Copy   


  • RRID:WB-STRAIN:WBStrain00037518

http://www.wormbase.org/db/get?name=WBStrain00037518

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00013001(noa-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00013001(noa-1)
Availability: available
Source References: EMPTY
Synonyms: Y48E1B.2(ok3557)/mT1 II; +/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2736, CGC_VC2736
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y48E1B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3557 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCGCGTACTTCTCCAACAAT. External right primer: TCTCGCAATCGGAATCTTCT. Internal left primer: CAGCTCTCTCCACCGTCTTC. Internal right primer: ACGTTCAGGAGGTCACCAAC. Internal WT amplicon: 1169 bp. Deletion size: 674 bp. Deletion left flank: GCAAGCCTCGGGTAGATGCTTCCGGGAAGA. Deletion right flank: CAGAATCTTCTGATAGCTGGGCTCCTGGCT."

Proper citation: RRID:WB-STRAIN:WBStrain00037518 Copy   


  • RRID:WB-STRAIN:WBStrain00037510

http://www.wormbase.org/db/get?name=WBStrain00037510

Source Database: WormBase (WB)
Affected Genes: WBGene00009940(strl-1)
Genomic Alteration: WBGene00009940(strl-1)
Availability: available
Source References: PMID:38378122
Synonyms: F52F12.7(ok3347) I.
Alternate IDs: WB-STRAIN:VC2712, CGC_VC2712
Notes: F52F12.7. External left primer: ATTGTCGCGGAATTTTATCG. External right primer: CGATTCGTGACCGTATCCAT. Internal left primer: CAAACACCATGACGCAAAAC. Internal right primer: CGTCCGATGACCTGATTAAC. Internal WT amplicon: 1151 bp. Deletion size: 547 bp. Deletion left flank: GGAATGGAATGGAAGCTCTTCCCGAGTGGA. Deletion right flank: CTGATTTGAAAGGATACCTCCCAAAAATGA. Insertion Sequence: TTTATTTGAAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037510 Copy   


  • RRID:WB-STRAIN:WBStrain00037511

http://www.wormbase.org/db/get?name=WBStrain00037511

Source Database: WormBase (WB)
Affected Genes: WBGene00001559(gei-1)|WBGene00016085(C25A8.5)
Genomic Alteration: WBGene00001559(gei-1), WBGene00016085(C25A8.5)
Availability: available
Source References: EMPTY
Synonyms: gei-1(gk3062) III; C25A8.5(gk1224) IV.
Alternate IDs: WB-STRAIN:VC2725, CGC_VC2725
Notes: C25A8.5, F45H7.2. The allele gk1224 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: GTGGAGCGTTCGGTACATTT. External right primer: TCACACCCCTGACAGGTACA. Internal left primer: AACGGAACCGTTGAGAATTG. Internal right primer: GCCGCCTCACAAGTTAGTTT. Internal WT amplicon: 2303 bp. Deletion size: 1432 bp. Deletion left flank: TTTCCAACGAAAATGTGACTTTTTCAGGAA. Deletion right flank: ATCTACCCATCTTGAGATCAAAACTTTCGA. Insertion Sequence: CAATTTTATTTTAAAAAATGCTCTGTGCCGCTTTTGTCGATACAACTTCTGAAATTTTC AAAACCACCGCGGTGCCTCCCAGTAGGACTTCAAAAATTG. The allele gk3062 was identified by CGH but not confirmed by PCR. Left flanking probe: GAAAAAGATGGATCTAAGATCCACTAATAAGTGAGTACACATACAGTGTG. Right flanking probe: GAAATTTGATTCCGGACCGTATGTACGATGATCTCGATGACCTACCTCTG. Left deleted probe: ATCTACTGTTTGCAGACGACCAAAAGAAACACGTGGCAGACCTGCTCCAA. Right deleted probe: GTTATTTTGTTTTTATCAGCTTCAAGGCGGTCTACATCTGCCTTGCGCCT.|"C25A8.5, F45H7.2. The allele gk1224 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: GTGGAGCGTTCGGTACATTT. External right primer: TCACACCCCTGACAGGTACA. Internal left primer: AACGGAACCGTTGAGAATTG. Internal right primer: GCCGCCTCACAAGTTAGTTT. Internal WT amplicon: 2303 bp. Deletion size: 1432 bp. Deletion left flank: TTTCCAACGAAAATGTGACTTTTTCAGGAA. Deletion right flank: ATCTACCCATCTTGAGATCAAAACTTTCGA. Insertion Sequence: CAATTTTATTTTAAAAAATGCTCTGTGCCGCTTTTGTCGATACAACTTCTGAAATTTTCAAAACCACCGCGGTGCCTCCCAGTAGGACTTCAAAAATTG. The allele gk3062 was identified by CGH but not confirmed by PCR. Left flanking probe: GAAAAAGATGGATCTAAGATCCACTAATAAGTGAGTACACATACAGTGTG. Right flanking probe: GAAATTTGATTCCGGACCGTATGTACGATGATCTCGATGACCTACCTCTG. Left deleted probe: ATCTACTGTTTGCAGACGACCAAAAGAAACACGTGGCAGACCTGCTCCAA. Right deleted probe: GTTATTTTGTTTTTATCAGCTTCAAGGCGGTCTACATCTGCCTTGCGCCT."|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037511 Copy   


  • RRID:WB-STRAIN:WBStrain00037596

http://www.wormbase.org/db/get?name=WBStrain00037596

Source Database: WormBase (WB)
Affected Genes: WBGene00007961(C35D6.4)
Genomic Alteration: WBGene00007961(C35D6.4)
Availability: available
Source References: EMPTY
Synonyms: C35D6.4(gk1281) IV.
Alternate IDs: WB-STRAIN:VC2933, CGC_VC2933
Notes: C35D6.4. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: TGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037596 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X