Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 142 showing 2821 ~ 2840 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00035075

http://www.wormbase.org/db/get?name=WBStrain00035075

Source Database: WormBase (WB)
Affected Genes: WBGene00004027(pie-1)
Genomic Alteration: WBGene00004027(pie-1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:TX673
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035075 Copy   

    • RRID:WB-STRAIN:WBStrain00035078

http://www.wormbase.org/db/get?name=WBStrain00035078

Source Database: WormBase (WB)
Affected Genes: WBGene00004027(pie-1)
Genomic Alteration: WBGene00004027(pie-1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:TX774
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035078 Copy   

    • RRID:WB-STRAIN:WBStrain00035077

http://www.wormbase.org/db/get?name=WBStrain00035077

Source Database: WormBase (WB)
Affected Genes: WBGene00001862(him-3)|WBGene00004027(pie-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001862(him-3), WBGene00004027(pie-1), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: teIs65 II; unc-119(ed3) III; him-3(e1147) IV.
Alternate IDs: WB-STRAIN:TX773, CGC_TX773
Notes: teIs65 [pie-1p::GFP::plk-1(PBD) + unc-119(+)] II. Maintain at 25 degrees and by picking the most brightly fluorescing animals to avoid silencing of the transgene. teIs65 contains GFP fused to the PLK-1 protein-binding domain. Derived from injection of pRL1216. Reference: Nishi Y, et al. Development. 2008 Feb;135(4):687-97.

Proper citation: RRID:WB-STRAIN:WBStrain00035077 Copy   

    • RRID:WB-STRAIN:WBStrain00035081

http://www.wormbase.org/db/get?name=WBStrain00035081

Source Database: WormBase (WB)
Affected Genes: WBGene00001862(him-3)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001862(him-3), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; him-3(e1147) IV; teEx321.
Alternate IDs: WB-STRAIN:TX796, CGC_TX796
Notes: teEx321[pRL1636 (Pmed-1::GFP::sys-1) pDPmm016]. GFP signal is very weak and can't be see using a dissecting microscope. Very low transmission. Most signal is nuclear and the signal is stronger in the posterior sister, e.g., MSp stronger than MSa, Ep stronger than Ea. Some cortical signal was also detected. Some larvae lack anterior gut or have gaps. Maintain by picking non-Uncs.

Proper citation: RRID:WB-STRAIN:WBStrain00035081 Copy   

    • RRID:WB-STRAIN:WBStrain00035080

http://www.wormbase.org/db/get?name=WBStrain00035080

Source Database: WormBase (WB)
Affected Genes: WBGene00001862(him-3)|WBGene00004027(pie-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001862(him-3), WBGene00004027(pie-1), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; him-3(e1147) IV; teIs70.
Alternate IDs: WB-STRAIN:TX787
Notes: teIs70 [pie-1p::GFP::plk-1 + unc-119(+)] II. Maintain at 25 degrees and by picking the most brightly fluorescing animals to avoid silencing of the transgene. teIs70 contains GFP fused to full-length PLK-1. Derived from injection of pRL766. Reference: Nishi Y, et al. Development. 2008 Feb;135(4):687-97.

Proper citation: RRID:WB-STRAIN:WBStrain00035080 Copy   

    • RRID:WB-STRAIN:WBStrain00035083

http://www.wormbase.org/db/get?name=WBStrain00035083

Source Database: WormBase (WB)
Affected Genes: WBGene00001862(him-3)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001862(him-3), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: teIs90 I; unc-119(ed3) III; him-3(e1147) IV.
Alternate IDs: WB-STRAIN:TX903, CGC_TX903
Notes: teIs90 [(pRL1483) pie-1p::GFP::taf-4 + unc119(+)]. Sick at high temperatures. Maintain at 20C, but it will silence after some generations.

Proper citation: RRID:WB-STRAIN:WBStrain00035083 Copy   

    • RRID:WB-STRAIN:WBStrain00035087

http://www.wormbase.org/db/get?name=WBStrain00035087

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; teIs127.
Alternate IDs: WB-STRAIN:TX1377, CGC_TX1377
Notes: teIs127 [pie-1p::GFP::H2B::mom-2 3'UTR + unc-119(+)] teIs127 construct includes a 557 bp genomic sequence beginning 100 bp upstream of the mom-2 stop codon was cloned downstream of pie-1 promoter-driven GFP::H2B. Superficially wild-type. Reference: Oldenbroek M, et al. Development. 2013 Nov;140(22):4614-23.

Proper citation: RRID:WB-STRAIN:WBStrain00035087 Copy   

    • RRID:WB-STRAIN:WBStrain00035201

http://www.wormbase.org/db/get?name=WBStrain00035201

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:UA197
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035201 Copy   

    • RRID:WB-STRAIN:WBStrain00035167

http://www.wormbase.org/db/get?name=WBStrain00035167

Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)|WBGene00004254(pxf-1)
Genomic Alteration: WBGene00001079(dpy-20), WBGene00004254(pxf-1)
Availability: available
Source References: EMPTY
Synonyms: pxf-1(pk1331) dpy-20(e1362) IV; pkEx10.
Alternate IDs: WB-STRAIN:TZ101, CGC_TZ101
Notes: Mutagen:UV/TMP|"pkEx10 [T14G10 + dpy-20(+)]. Maintain by picking WT."

Proper citation: RRID:WB-STRAIN:WBStrain00035167 Copy   

    • RRID:WB-STRAIN:WBStrain00035200

http://www.wormbase.org/db/get?name=WBStrain00035200

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:22033521
Synonyms: [baInl32; Peat-4::ssABeta 1-42, Peat-4::gfp, Pmyo-2::mCherry]; baEx116; [Peat-4::lacZ, rol-6 (su1006)]
Alternate IDs: WB-STRAIN:UA175
Notes: Generated by directly injecting 50 g/mL of putative ssABeta 1-42 toxicity modifiers and rol-6 into UA166 [baInl32; Peat-4::ssABeta 1-42, Peat-4::gfp, Pmyo-2::mCherry].

Proper citation: RRID:WB-STRAIN:WBStrain00035200 Copy   

    • RRID:WB-STRAIN:WBStrain00035171

http://www.wormbase.org/db/get?name=WBStrain00035171

Source Database: WormBase (WB)
Affected Genes: WBGene00006598(tor-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00006598(tor-2), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Q19::GFP
Alternate IDs: WB-STRAIN:UA3
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035171 Copy   

    • RRID:WB-STRAIN:WBStrain00035173

http://www.wormbase.org/db/get?name=WBStrain00035173

Source Database: WormBase (WB)
Affected Genes: WBGene00006598(tor-2)
Genomic Alteration: WBGene00006598(tor-2)
Availability: unknown
Source References: EMPTY
Synonyms: Q19::GFP+TOR-2
Alternate IDs: WB-STRAIN:UA5
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035173 Copy   

    • RRID:WB-STRAIN:WBStrain00035177

http://www.wormbase.org/db/get?name=WBStrain00035177

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:UA38
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035177 Copy   

    • RRID:WB-STRAIN:WBStrain00035176

http://www.wormbase.org/db/get?name=WBStrain00035176

Source Database: WormBase (WB)
Affected Genes: WBGene00006598(tor-2)
Genomic Alteration: WBGene00006598(tor-2)
Availability: unknown
Source References: EMPTY
Synonyms: Q82::GFP+TOR-2(delta368)
Alternate IDs: WB-STRAIN:UA8
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035176 Copy   

    • RRID:WB-STRAIN:WBStrain00035184

http://www.wormbase.org/db/get?name=WBStrain00035184

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:UA132
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035184 Copy   

    • RRID:WB-STRAIN:WBStrain00035183

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035183

Source Database: WormBase (WB)
Availability: available
Source References: PMID:31323240
Synonyms: baIs4.
Alternate IDs: WB-STRAIN:UA57, CGC_UA57
Notes: baIs4 [dat-1p::GFP + dat-1p::CAT-2]. GFP expression in CEP, ADE and PDE neurons. From integration of baEx33.|"Made_by: Caldwell Lab"|"WBStrain mapped, WBPaper00060404 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00035183 Copy   

    • RRID:WB-STRAIN:WBStrain00035186

http://www.wormbase.org/db/get?name=WBStrain00035186

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:UA134
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035186 Copy   

    • RRID:WB-STRAIN:WBStrain00035185

http://www.wormbase.org/db/get?name=WBStrain00035185

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:UA133
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035185 Copy   

    • RRID:WB-STRAIN:WBStrain00035144

http://www.wormbase.org/db/get?name=WBStrain00035144

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:26024448
Synonyms: unc-119(ed3) ruIs32 III; ojIs1.
Alternate IDs: WB-STRAIN:TY3558, CGC_TY3558
Notes: ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Histone and tubulin GFP.

Proper citation: RRID:WB-STRAIN:WBStrain00035144 Copy   

    • RRID:WB-STRAIN:WBStrain00035145

http://www.wormbase.org/db/get?name=WBStrain00035145

Source Database: WormBase (WB)
Affected Genes: WBGene00004750(sea-1)
Genomic Alteration: WBGene00004750(sea-1)
Availability: available
Source References: EMPTY
Synonyms: sea-1(y356) II.
Alternate IDs: WB-STRAIN:TY3579, CGC_TY3579
Notes: Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.

Proper citation: RRID:WB-STRAIN:WBStrain00035145 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The PRECISE-TBI toolbox are a collection tools and resources to increase rigor and reproducibility with Traumatic Brain Injury within the PRE Clinical Interagency reSearch resourcE - Traumatic Brain Injury (PRECISE-TBI). Please learn more about PRECISE-TBI at https://www.precise-tbi.org

Recent News Entries

Contact Us

Department of Neurosciences, School of Medicine

University of California, San Diego





About SciCrunch | Privacy Policy | Terms of Service

SciCrunch