Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SV1877 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034624 | Caenorhabditis elegans | ebp-2(he278) II; ebp-1 & Y59A8B.25 & ebp-3(he279) V. | he278 is a CRISPR-induced deletion of ebp-2. he279 is a deletion removing ebp-1, Y59A8B.25 & ebp-3. Low penetrance of pleiotropic phenotypes among adults, including low frequency of dumpy, sterile and/or uncoordinated animals and nonviable larvae that explode through the vulva. Some adults develop irregularities that seem to represent epidermal bulges. Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 27772793. doi: 10.1083/jcb.201607038 | WBGene00007062(ebp-3)|WBGene00012156(ebp-2)|WBGene00013344(ebp-1) | WBGene00007062(ebp-3), WBGene00012156(ebp-2), WBGene00013344(ebp-1) | WB-STRAIN:WBStrain00034624 | WormBase (WB) | WB | available | WB-STRAIN:SV1877, CGC_SV1877 | 2026-08-01 10:19:16 | 0 | |||
|
SWF5 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034625 | Caenorhabditis elegans | flvEx4. | flvEx4 [rig-3p::wArchon1::GFP + sra-6::ChR2-GFP + elt-2p::nGFP]. Pick GFP+ to maintain. Voltage-sensor protein wArchon1 transgene injected into N2 background. Reference: Piatkevich KD, et al. Nature Chemical Biology. 2018. doi:10.1038/s41589-018-0004-9.|"Made_by: Steven Flavell" | WB-STRAIN:WBStrain00034625 | WormBase (WB) | WB | available | WB-STRAIN:SWF5, CGC_SWF5 | 2026-08-01 10:19:18 | 0 | |||||
|
SX158 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034629 | Caenorhabditis elegans | prg-1(n4357) I. | 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT|"Mutagen:EMS/Tc3"|"Twitching due to transposon insertion in unc-22."|"Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.]" | WBGene00004178(prg-1)|WBGene00006759(unc-22) | WBGene00004178(prg-1), WBGene00006759(unc-22) | WB-STRAIN:WBStrain00034629 | WormBase (WB) | WB | available | PMID:31839537 | WB-STRAIN:SX158, CGC_SX158 | 2026-08-01 10:19:17 | 0 | ||
|
SV1578 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034620 | Caenorhabditis elegans | unc-119(ed3) III; heIs105 IV; swsn-1(os22) heSi164 V; heSi141 X. | heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi164 [rps-27::loxN::NLS::mCherry::let858 UTR::swsn-1p::swsn-1::unc-54 UTR::loxN::NLS::GFP::let-858 UTR + unc-119(+)] V. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain the line at 15C and shift to 25C for mutant analysis. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi164 carries a swsn-1 rescue construct which ensures rescue of the temperature-sensitive swsn-1(os22) mutation. Upon expression of CRE (in this case in the mesoblast lineage) the swsn-1 gene will be excised, creating a mesoblast specific mutant of swsn-1. This recombination event can be visualized by a switch from red to green in those mesoblast cells in which swsn-1 was lost. The animals are healthy at 15C, but embryonic lethal and larval arrested at 23-25C. swsn-1(os22) causes mild overproliferation in the mesoblast lineage. The swsn-1 rescuing transgene is unable to rescue germline development of swsn-1(os22) mutants. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13. | WBGene00004203(swsn-1)|WBGene00006843(unc-119) | WBGene00004203(swsn-1), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034620 | WormBase (WB) | WB | available | PMID:32494730 | WB-STRAIN:SV1578, CGC_SV1578 | 2026-08-01 10:19:16 | 0 | ||
|
TG1756 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034678 | Caenorhabditis elegans | unc-119(ed3) III; ltIs37 IV. gtIs67. | gtIs67 [pie-1p::GFP(lap)::sld-5 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034678 | WormBase (WB) | WB | available | WB-STRAIN:TG1756, CGC_TG1756 | 2026-08-01 10:19:17 | 0 | |||
|
TG1681 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034670 | Caenorhabditis elegans | vtIs1 V; tsp-17(gt1681) X. | vtIs1 [dat-1p::GFP + rol-6] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767. | WBGene00006643(tsp-17) | WBGene00006643(tsp-17) | WB-STRAIN:WBStrain00034670 | WormBase (WB) | WB | available | WB-STRAIN:TG1681, CGC_TG1681 | 2026-08-01 10:19:18 | 0 | |||
|
TG1749 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034671 | Caenorhabditis elegans | unc-119(ed3) III; ltIs37 IV; gtIs60. | gtIs60 [pie-1p::GFP(lap)::orc-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034671 | WormBase (WB) | WB | available | WB-STRAIN:TG1749, CGC_TG1749 | 2026-08-01 10:19:17 | 0 | |||
|
TG1751 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034673 | Caenorhabditis elegans | unc-119(ed3) III; ltIs37 IV; gtIs62. | gtIs62 [pie-1p::GFP(lap)::cdc-6 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034673 | WormBase (WB) | WB | available | WB-STRAIN:TG1751, CGC_TG1751 | 2026-08-01 10:19:18 | 0 | |||
|
TG1753 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034675 | Caenorhabditis elegans | unc-119(ed3) III; ltIs37 IV; gtIs64. | gtIs64 [pie-1p::GFP(lap)::mcm-3 + unc-119(+)]. ltIs37 [(pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034675 | WormBase (WB) | WB | available | WB-STRAIN:TG1753, CGC_TG1753 | 2026-08-01 10:19:17 | 0 | |||
|
TG1754 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034676 | Caenorhabditis elegans | unc-119(ed3) III; ltIs37 IV; gtIs65. | gtIs65 [pie-1p::GFP(lap)::cdc-45 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034676 | WormBase (WB) | WB | available | WB-STRAIN:TG1754, CGC_TG1754 | 2026-08-01 10:19:18 | 0 | |||
|
TG1755 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034677 | Caenorhabditis elegans | unc-119(ed3) III; ltIs37 IV; gtIs66. | gtIs66 [pie-1p::GFP(lap)::div-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034677 | WormBase (WB) | WB | available | WB-STRAIN:TG1755, CGC_TG1755 | 2026-08-01 10:19:17 | 0 | |||
|
TG1868 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034680 | Caenorhabditis elegans | slx-1(tm2644) I. | Reference: Agostinho A, et al. PLos Genetics 2013.|"Supplementary_genotype slx-1(tm2644)" | WBGene00018909(slx-1) | WBGene00018909(slx-1) | WB-STRAIN:WBStrain00034680 | WormBase (WB) | WB | available | PMID:36176234 | WB-STRAIN:TG1868, CGC_TG1868 | 2026-08-01 10:19:17 | 1 | ||
|
SV314 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034602 | Caenorhabditis elegans | rol-1(e91) cyd-1(he112)/mnC1 [dpy-10(e28) unc-52(e444)] II. | Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1. | WBGene00000870(cyd-1)|WBGene00001072(dpy-10)|WBGene00004394(rol-1)|WBGene00006787(unc-52) | WBGene00000870(cyd-1), WBGene00001072(dpy-10), WBGene00004394(rol-1), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00034602 | WormBase (WB) | WB | available | WB-STRAIN:SV314, CGC_SV314 | 2026-08-01 10:19:16 | 2 | |||
|
SV327 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034603 | Caenorhabditis elegans | cdc-14(he118) II. | Extra cell divisions within several cell lineages.|"Made_by: R.M. Saito" | WBGene00000383(cdc-14) | WBGene00000383(cdc-14) | WB-STRAIN:WBStrain00034603 | WormBase (WB) | WB | available | WB-STRAIN:SV327, CGC_SV327 | 2026-08-01 10:19:16 | 0 | |||
|
SV411 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034605 | Caenorhabditis elegans | heDf1 maIs103/lon-2(e678) unc-9(e101) X. | maIs103[rnr::GFP unc-36(+)] X. The heDf1 deletion includes cdk-4. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. heDf1 mutants are of L1 size, smaller than cdk-4 mutants. lon-2 and unc-9 do not exactly balance heDf1, but unc-9 is pretty close. It should also be possible to follow the heterozygotes by looking at the GFP. Despite trying, unable to separate the maIs integration from heDf1 or the other cdk-4 alleles. By maintaining animals with GFP (visible especially in early animals and in eggs) you should be able to maintain heDf1. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. maIs103 is tightly linked to heDf1. Maintain by picking several single animals and scoring for 1/4 mutant progeny. | WBGene00003056(lon-2)|WBGene00006749(unc-9) | WBGene00003056(lon-2), WBGene00006749(unc-9) | WB-STRAIN:WBStrain00034605 | WormBase (WB) | WB | available | WB-STRAIN:SV411, CGC_SV411 | 2026-08-01 10:19:16 | 0 | |||
|
SV557 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034606 | Caenorhabditis elegans | cdc-14(he141) II. | Extra cell divisions within several cell lineages.|"Made_by: R.M. Saito" | WBGene00000383(cdc-14) | WBGene00000383(cdc-14) | WB-STRAIN:WBStrain00034606 | WormBase (WB) | WB | available | WB-STRAIN:SV557, CGC_SV557 | 2026-08-01 10:19:16 | 1 | |||
|
TG1878 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034681 | Caenorhabditis elegans | mus-81(tm1937) slx-1(tm2644) I. | Reference: Agostinho A, et al. PLos Genetics 2013. | WBGene00016602(mus-81)|WBGene00018909(slx-1) | WBGene00016602(mus-81), WBGene00018909(slx-1) | WB-STRAIN:WBStrain00034681 | WormBase (WB) | WB | available | WB-STRAIN:TG1878, CGC_TG1878 | 2026-08-01 10:19:17 | 0 | |||
|
TG1890 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034682 | Caenorhabditis elegans | mus-81(tm1937) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II. | Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013. | WBGene00000254(bli-4)|WBGene00008140(xpf-1)|WBGene00016602(mus-81) | WBGene00000254(bli-4), WBGene00008140(xpf-1), WBGene00016602(mus-81) | WB-STRAIN:WBStrain00034682 | WormBase (WB) | WB | available | WB-STRAIN:TG1890, CGC_TG1890 | 2026-08-01 10:19:19 | 0 | |||
|
TG1891 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034683 | Caenorhabditis elegans | slx-1(tm2644) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II. | Segregates WT GFP+ heterozygotes, non-GFP slx-1; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1 xpf-1 double homozygotes are viable. Reference: Agostinho A, et al. PLos Genetics 2013. | WBGene00000254(bli-4)|WBGene00008140(xpf-1)|WBGene00018909(slx-1) | WBGene00000254(bli-4), WBGene00008140(xpf-1), WBGene00018909(slx-1) | WB-STRAIN:WBStrain00034683 | WormBase (WB) | WB | available | WB-STRAIN:TG1891, CGC_TG1891 | 2026-08-01 10:19:17 | 0 | |||
|
TG1975 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034684 | Caenorhabditis elegans | slx-1(tm2644) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-6(ok412) IV. | Him. Heterozygotes are WT. Segregates WT GFP+ heterozygotes, non-GFP slx-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1(tm2644) homozygotes are viable. Reference: Agostinho A, et al. PLos Genetics 2013. | WBGene00000254(bli-4)|WBGene00001865(him-6)|WBGene00018909(slx-1) | WBGene00000254(bli-4), WBGene00001865(him-6), WBGene00018909(slx-1) | WB-STRAIN:WBStrain00034684 | WormBase (WB) | WB | unknown | WB-STRAIN:TG1975 | 2026-08-01 10:19:17 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
