Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
STR199 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034534 | Caenorhabditis elegans | wdIs51; hrtEx53. | wdIs51 [F49H12.4::GFP + unc-119(+)]; likely integrated in X. hrtEx53 [des-2p::mKate::GS1(low) + unc-119(+) + myo-2p::tdTomato]. Pick tdTomato+ animals to maintain. PVD development is somewhat affected by moderate levels of actin-perturbing DeAct-GS1 expression in PVD and FLP. Phenotype is less severe than that of the high DeAct-GS1 expressing strain STR198 and DeAct-SpvB expressing strain STR200. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. | WB-STRAIN:WBStrain00034534 | WormBase (WB) | WB | available | PMID:28394337 | WB-STRAIN:STR199, CGC_STR199 | 2026-08-01 10:19:15 | 0 | ||||
|
STR222 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034540 | Caenorhabditis elegans | unc-119(ed3); hrtEx66[Pwrt-2::mKate2::ePDZ; Pwrt-2::PH::gfp::LOVpep + cb-unc-119(+)] | EMPTY | WB-STRAIN:WBStrain00034540 | WormBase (WB) | WB | unknown | PMID:26906482 | WB-STRAIN:STR222 | 2026-08-01 10:19:15 | 0 | ||||
|
STR254 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034545 | Caenorhabditis elegans | unc-119(ed3); hrtSi24[Pgcy-36::tomm-20(aa1-41)::mKate2::LOVpep]; hrtEx78[Pgcy-36::unc-116 (aa1-381)::gfp::ePDZ; Pmyo-2::TdTomato] | EMPTY | WB-STRAIN:WBStrain00034545 | WormBase (WB) | WB | unknown | PMID:26906482 | WB-STRAIN:STR254 | 2026-08-01 10:19:15 | 0 | ||||
|
SX333 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034634 | Caenorhabditis elegans | mjIs11 III; mjIs17 IV. | Made_by: Nicholas Lehrbach|"mjIs11 contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)]." | WB-STRAIN:WBStrain00034634 | WormBase (WB) | WB | available | WB-STRAIN:SX333, CGC_SX333 | 2026-08-01 10:19:18 | 0 | |||||
|
SX340 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034635 | Caenorhabditis elegans | unc-32(e189) mut-7(pk204) pha-1(e2123) III; ccEx7271. | ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Germ cell expression can be observed when maintained at 25C. Germline transgene silencing is abnormal. | WBGene00003504(mut-7)|WBGene00004010(pha-1)|WBGene00006768(unc-32) | WBGene00003504(mut-7), WBGene00004010(pha-1), WBGene00006768(unc-32) | WB-STRAIN:WBStrain00034635 | WormBase (WB) | WB | available | WB-STRAIN:SX340, CGC_SX340 | 2026-08-01 10:19:17 | 0 | |||
|
SX166 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034630 | Caenorhabditis elegans | prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. | Mutagen:EMS(n4357 & n4358) Curator_confirmed WBPerson1983|"Transposon silencing normal." | WBGene00004178(prg-1)|WBGene00004179(prg-2)|WBGene00006759(unc-22) | WBGene00004178(prg-1), WBGene00004179(prg-2), WBGene00006759(unc-22) | WB-STRAIN:WBStrain00034630 | WormBase (WB) | WB | available | WB-STRAIN:SX166, CGC_SX166 | 2026-08-01 10:19:17 | 0 | |||
|
SX178 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034631 | Caenorhabditis elegans | prg-1(n4357) I; unc-22(r765) IV. | Mutagen:EMS/Tc4|"Twitching due to transposon insertion in unc-22." | WBGene00004178(prg-1)|WBGene00006759(unc-22) | WBGene00004178(prg-1), WBGene00006759(unc-22) | WB-STRAIN:WBStrain00034631 | WormBase (WB) | WB | available | WB-STRAIN:SX178, CGC_SX178 | 2026-08-01 10:19:18 | 0 | |||
|
SX328 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034633 | Caenorhabditis elegans | mjIs17 IV. | Made_by: Nicholas Lehrbach|"mjIs17 contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)]."|"mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry:unc-54 (let-7 sensor)]." | WB-STRAIN:WBStrain00034633 | WormBase (WB) | WB | available | WB-STRAIN:SX328, CGC_SX328 | 2026-08-01 10:19:17 | 0 | |||||
|
SX2499 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034646 | Caenorhabditis elegans | prde-1(mj207) V. | piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96. | WBGene00008995(prde-1) | WBGene00008995(prde-1) | WB-STRAIN:WBStrain00034646 | WormBase (WB) | WB | available | WB-STRAIN:SX2499, CGC_SX2499 | 2026-08-01 10:19:18 | 0 | |||
|
SX922 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034642 | Caenorhabditis elegans | prg-1(n4357) I. | 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT|"no longer available from the CGC." | WBGene00004178(prg-1) | WBGene00004178(prg-1) | WB-STRAIN:WBStrain00034642 | WormBase (WB) | WB | available | PMID:31402283 PMID:33086057 |
WB-STRAIN:SX922, CGC_SX922 | 2026-08-01 10:19:17 | 0 | ||
|
SV1361 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034612 | Caenorhabditis elegans | unc-119(ed3) III; heIs105 IV. | heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Strain is viable at 15-25 C. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination by a switch from red to green. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034612 | WormBase (WB) | WB | available | WB-STRAIN:SV1361, CGC_SV1361 | 2026-08-01 10:19:16 | 0 | |||
|
SV1438 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034613 | Caenorhabditis elegans | unc-119(ed3) III; heSi141 X. | heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Strain is viable at 15-25 C, but non-tissue specific recombination is observed more frequently in other tissues at higher temperatures (25C). Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034613 | WormBase (WB) | WB | available | WB-STRAIN:SV1438, CGC_SV1438 | 2026-08-01 10:19:17 | 0 | |||
|
SV1439 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034614 | Caenorhabditis elegans | unc-119(ed3) III; heSi142 X. | heSi142 [elt-2::FLAG::CRE::tbb-2 + unc-119(+)] X. Expression of CRE recombinase in the intestine driven by the elt-2 promoter. Strain is viable at 15-25 C, but non-tissue specific recombination is observed more frequently in other tissues at higher temperatures (25C). Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034614 | WormBase (WB) | WB | available | WB-STRAIN:SV1439, CGC_SV1439 | 2026-08-01 10:19:16 | 0 | |||
|
SV1450 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034617 | Caenorhabditis elegans | unc-119(ed3) III; heIs145 IV | heIs145 [rps-27::loxP::NLS::mCherry::let858 UTR::eft-3::tagBFP::tbb-2 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Maintain at 15-25C. heIs145 expresses a read-out construct used to visualize CRE activity and specificity, and to test whether CRE expression is likely to induce loss of a gene of interest (tagBFP in this case) in a given tissue. Expression of CRE will result in a change from mCherry to GFP and loss of tagBFP expression in those cells where CRE is active. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034617 | WormBase (WB) | WB | available | WB-STRAIN:SV1450, CGC_SV1450 | 2026-08-01 10:19:16 | 0 | |||
|
SV1461 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034618 | Caenorhabditis elegans | unc-119(ed3) III; heSi148 X. | heSi148 [myo-3::CRE::tbb-2 UTR + unc-119(+)] X. Inserted at ttTi14024. Maintain at 15-25C. Expression of CRE recombinase in differentiated body wall muscle cells driven by the myo-3 promoter. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.|"No longer available from the CGC" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034618 | WormBase (WB) | WB | unknown | WB-STRAIN:SV1461 | 2026-08-01 10:19:16 | 0 | |||
|
TG2415 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034692 | Caenorhabditis elegans | vtIs1 dop-2(vs105) V; dop-1(vs100) dop-3(vs106) X. | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767. | WBGene00001052(dop-1)|WBGene00001053(dop-2)|WBGene00020506(dop-3) | WBGene00001052(dop-1), WBGene00001053(dop-2), WBGene00020506(dop-3) | WB-STRAIN:WBStrain00034692 | WormBase (WB) | WB | available | WB-STRAIN:TG2415, CGC_TG2415 | 2026-08-01 10:19:18 | 0 | |||
|
TG2435 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034694 | Caenorhabditis elegans | vtIs1 V. | vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll well, but GFP expression is easily detected. Reference: Nass R, et al. Proc Natl Acad Sci U S A. 2002 Mar 5;99(5):3264-9. Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767. | WB-STRAIN:WBStrain00034694 | WormBase (WB) | WB | available | PMID:36719882 PMID:37528117 PMID:39950089 PMID:39746999 |
WB-STRAIN:TG2435, CGC_TG2435 | 2026-08-01 10:19:19 | 1 | ||||
|
TG2452 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034697 | Caenorhabditis elegans | mus-81(tm1937) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II; gtIs2512. | gtIs2512 [pie-1p::his-11::GFP + unc-119(+)]. Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013. | WBGene00000254(bli-4)|WBGene00008140(xpf-1)|WBGene00016602(mus-81) | WBGene00000254(bli-4), WBGene00008140(xpf-1), WBGene00016602(mus-81) | WB-STRAIN:WBStrain00034697 | WormBase (WB) | WB | available | WB-STRAIN:TG2452, CGC_TG2452 | 2026-08-01 10:19:19 | 0 | |||
|
SV1317 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034611 | Caenorhabditis elegans | heSi101 I; unc-119(ed3) III. | heSi101 [tcc-1p::tcc-1::mCherry::tcc-1 3' UTR + Cbr-unc-119(+)] I. TCC-1::mCherry associates with the mitotic spindle, nuclear envelope, and plasma membrane. Reference: Berends CWH, et al. Mol Biol Cell. 2013 Jul;24(14):2201-15.|"no longer available from the CGC." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034611 | WormBase (WB) | WB | available | WB-STRAIN:SV1317, CGC_SV1317 | 2026-08-01 10:19:16 | 0 | |||
|
SV1803 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034623 | Caenorhabditis elegans | dhc-1(he264[eGFP::dhc-1]) I. | This strain carries endogenously tagged dynein heavy chain (egfp::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 27772793. doi: 10.1083/jcb.201607038 | WBGene00000962(dhc-1) | WBGene00000962(dhc-1) | WB-STRAIN:WBStrain00034623 | WormBase (WB) | WB | available | WB-STRAIN:SV1803, CGC_SV1803 | 2026-08-01 10:19:16 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
