Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SP2123 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034402 | Caenorhabditis elegans | mec-8(u218) smu-1(mn602) I; unc-52(e669su250ts) II. | Made_by: R Herman|"Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95." | WBGene00003172(mec-8)|WBGene00004895(smu-1)|WBGene00006787(unc-52) | WBGene00003172(mec-8), WBGene00004895(smu-1), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00034402 | WormBase (WB) | WB | available | WB-STRAIN:SP2123, CGC_SP2123 | 2026-08-01 10:19:13 | 0 | |||
|
ST66 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034490 | Caenorhabditis elegans | ncIs17. | Mutagen:Gamma rays|"ncIs17 contains [hsp-16.2::eGFP + pBluscript]. Superficially wild-type." | WB-STRAIN:WBStrain00034490 | WormBase (WB) | WB | available | WB-STRAIN:ST66, CGC_ST66 | 2026-08-01 10:19:15 | 0 | |||||
|
ST205 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034492 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00034492 | WormBase (WB) | WB | unknown | WB-STRAIN:ST205 | 2026-08-01 10:19:14 | 0 | |||||
|
SS629 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034450 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00004027(pie-1) | WBGene00004027(pie-1) | WB-STRAIN:WBStrain00034450 | WormBase (WB) | WB | unknown | WB-STRAIN:SS629 | 2026-08-01 10:19:14 | 0 | |||
|
SS712 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034451 | Caenorhabditis elegans | ife-1(bn127) III. | Made_by: Dunkelbarger/Strome|"Mutagen:UV/TMP"|"Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt" | WBGene00002059(ife-1) | WBGene00002059(ife-1) | WB-STRAIN:WBStrain00034451 | WormBase (WB) | WB | available | WB-STRAIN:SS712, CGC_SS712 | 2026-08-01 10:19:15 | 2 | |||
|
SS727 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034452 | Caenorhabditis elegans | pgl-2(bn123) III. | Fertile at all temperatures.|"Mutagen:UV/TMP" | WBGene00003993(pgl-2) | WBGene00003993(pgl-2) | WB-STRAIN:WBStrain00034452 | WormBase (WB) | WB | available | WB-STRAIN:SS727, CGC_SS727 | 2026-08-01 10:19:14 | 0 | |||
|
SS730 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034454 | Caenorhabditis elegans | pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV. | Mutagen:UV/TMP|"Unc. Maintain at 15C. Sterile at higher temperatures." | WBGene00003992(pgl-1)|WBGene00003993(pgl-2)|WBGene00006761(unc-24) | WBGene00003992(pgl-1), WBGene00003993(pgl-2), WBGene00006761(unc-24) | WB-STRAIN:WBStrain00034454 | WormBase (WB) | WB | available | WB-STRAIN:SS730, CGC_SS730 | 2026-08-01 10:19:15 | 0 | |||
|
SS731 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034455 | Caenorhabditis elegans | pgl-2(bn123) III; pgl-3(bn104) dpy-11(e224) V. | Dpy. Fertile at all temperatures.|"Mutagen:UV/TMP" | WBGene00001073(dpy-11)|WBGene00003993(pgl-2)|WBGene00003994(pgl-3) | WBGene00001073(dpy-11), WBGene00003993(pgl-2), WBGene00003994(pgl-3) | WB-STRAIN:WBStrain00034455 | WormBase (WB) | WB | available | WB-STRAIN:SS731, CGC_SS731 | 2026-08-01 10:19:14 | 0 | |||
|
SS733 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034456 | Caenorhabditis elegans | pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V. | Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.|"Mutagen:UV/TMP" | WBGene00001073(dpy-11)|WBGene00003992(pgl-1)|WBGene00003993(pgl-2)|WBGene00003994(pgl-3)|WBGene00006761(unc-24) | WBGene00001073(dpy-11), WBGene00003992(pgl-1), WBGene00003993(pgl-2), WBGene00003994(pgl-3), WBGene00006761(unc-24) | WB-STRAIN:WBStrain00034456 | WormBase (WB) | WB | available | WB-STRAIN:SS733, CGC_SS733 | 2026-08-01 10:19:14 | 0 | |||
|
SS746 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034457 | Caenorhabditis elegans | klp-19(bn126)/mT1 [dpy-10(e128)] III. | Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2.|"Mutagen:UV/TMP"|"Supplementary_genotype klp-19(bn126)mT1[dpy-10(e128)] III." | WBGene00001072(dpy-10)|WBGene00002229(klp-19) | WBGene00001072(dpy-10), WBGene00002229(klp-19) | WB-STRAIN:WBStrain00034457 | WormBase (WB) | WB | available | PMID:36617680 | WB-STRAIN:SS746, CGC_SS746 | 2026-08-01 10:19:15 | 0 | ||
|
ST6 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034469 | Caenorhabditis elegans | eat-20(nc4) | Starved appearance: shorter body length, pale intestine, reduced pharyngeal pumping, smaller brood size and extended egg-laing period. | WBGene00001148(eat-20) | WBGene00001148(eat-20) | WB-STRAIN:WBStrain00034469 | WormBase (WB) | WB | available | PMID:10655217 | WB-STRAIN:ST6, CGC_ST6 | 2026-08-01 10:19:15 | 0 | ||
|
SSM2 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034461 | Caenorhabditis elegans | mre-11(iow1)/nT1[qIs51] (IV;V). | Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP iow1 homozygotes (viable; see note below). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. iow1 is a separation-of-function allele of mre-11. Homozygotes develop into adults wild-type in appearance, but laying dead eggs due to defects in meiotic DSB repair: mre-11(iow1) worms form meiotic DSBs but are impaired in their resection. Pick GFP+ to maintain (mre-11(iow1)/nT1[qIs51]) and GFP- to obtain homozygous mre-11(iow1) worms for analysis. Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47. doi: 10.1128/MCB.00055-13. Epub 2013 May 13. Erratum in: Mol Cell Biol. 2015 Jul;35(14):2568. PubMed PMID: 23671188; PubMed Central PMCID: PMC3700128.|"Mutagen:UV/TMP" | WBGene00003405(mre-11) | WBGene00003405(mre-11) | WB-STRAIN:WBStrain00034461 | WormBase (WB) | WB | available | WB-STRAIN:SSM2, CGC_SSM2 | 2026-08-01 10:19:14 | 0 | |||
|
SSM72 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034463 | Caenorhabditis elegans | exo-1(tm1842) III. | Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47.|"Supplementary_genotype exo-1(tm1842)" | WBGene00009731(exo-1) | WBGene00009731(exo-1) | WB-STRAIN:WBStrain00034463 | WormBase (WB) | WB | available | PMID:36176234 | WB-STRAIN:SSM72, CGC_SSM72 | 2026-08-01 10:19:15 | 0 | ||
|
SSM264 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034464 | Caenorhabditis elegans | rad-51(iow53[GFP::rad-51]) IV/nT1[qIs51] (IV;V). | Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes. Balancer is prone to breaking down. If a population contains a mix of bright and dim GFP animals, pick dim GFP and check for correct segregation of progeny to maintain. iow53 inserted a GFP tag at the N-terminus of the endogenous rad-51 locus, but the tagged protein is not fully functional. non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes form GFP foci in the germline that are mostly spo-11 dependent, and GFP::rad-51 homozygotes have defects in unloading RAD-51. Created by CRISPR using pDD282, therefore may also contain 3XFLAG. Reference: Koury E, et al. Nucleic Acids Res. 2018 Jan 25;46(2):748-764.|"Made_by: Matthew Wheat and Emily Koury" | WBGene00004297(rad-51) | WBGene00004297(rad-51) | WB-STRAIN:WBStrain00034464 | WormBase (WB) | WB | available | WB-STRAIN:SSM264, CGC_SSM264 | 2026-08-01 10:19:14 | 1 | |||
|
SSM291 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034466 | Caenorhabditis elegans | ubc-9(iow31[3xFLAG::ubc-9]) IV/nT1[qIs51] (IV;V) | Heterozygotes are wild type with pharyngeal-expressed GFP, and segregate wild type GFP+ heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP ubc-9(iow31[3xFLAG::ubc-9]) homozygotes. ubc-9(iow31[3xFLAG::ubc-9]) homozygotes produce 100% dead embryos, but cytologically they have normal germline (examined by DAPI and RAD-51 staining), suggesting that 3xFLAG::ubc-9 is functional in the gonad but not in the non-maternally rescued embryo. Maintain the strain by picking GFP+ worms. 3XFLAG bas added by CRISPR/Cas9. Synonymous point mutation where included in the repair template (positions 30, 33 and 36 of coding sequence). Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.|"Made_by: Rachel Reichman"|"No longer available from the CGC" | WBGene00006706(ubc-9) | WBGene00006706(ubc-9) | WB-STRAIN:WBStrain00034466 | WormBase (WB) | WB | available | WB-STRAIN:SSM291, CGC_SSM291 | 2026-08-01 10:19:15 | 0 | |||
|
SS186 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00034436 | Caenorhabditis elegans | mes-2(bn11) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation.|"Supplementary_genotype mes-2(bn11); unc-4(e120)/mnC1[dpy-10(e128) unc-52(e444)] II" | WBGene00001072(dpy-10)|WBGene00003220(mes-2)|WBGene00006744(unc-4)|WBGene00006787(unc-52) | WBGene00001072(dpy-10), WBGene00003220(mes-2), WBGene00006744(unc-4), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00034436 | WormBase (WB) | WB | available | PMID:1783292 PMID:37818613 |
WB-STRAIN:SS186, CGC_SS186 | 2026-08-01 10:19:14 | 1 | ||
|
SS222 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034437 | Caenorhabditis elegans | mes-3(bn21) I. | Strict maternal effect sterile at 25C. TSP during embryogenesis. The progeny of homozygous mothers, raised at the restrictive temperature, are sterile. Sterile worms have dramatic reduction in number of germ cells (10-100 fold less than WT). | WBGene00003221(mes-3) | WBGene00003221(mes-3) | WB-STRAIN:WBStrain00034437 | WormBase (WB) | WB | available | PMID:1783292 | WB-STRAIN:SS222, CGC_SS222 | 2026-08-01 10:19:13 | 0 | ||
|
SS230 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034438 | Caenorhabditis elegans | unc-13(e51) I; him-5(e1490) V; nDp4 (I;V)/+. | Animals with the Duplication are WT. Animals which have lost the Duplication are Unc. Throws males. | WBGene00001864(him-5)|WBGene00006752(unc-13) | WBGene00001864(him-5), WBGene00006752(unc-13) | WB-STRAIN:WBStrain00034438 | WormBase (WB) | WB | available | WB-STRAIN:SS230, CGC_SS230 | 2026-08-01 10:19:13 | 0 | |||
|
SS262 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034439 | Caenorhabditis elegans | mes-3(bn35) dpy-5(e61) I; sDp2 (I;f). | Animals with the Duplication have a WT phenotype. Animals which have lost the Duplication are Dpy and give sterile Dpy progeny. Strict maternal effect sterile. Sterile worms have a dramatic reduction in number of germs cells (10-100 fold less than WT). See also WBPaper00002343. | WBGene00001067(dpy-5)|WBGene00003221(mes-3) | WBGene00001067(dpy-5), WBGene00003221(mes-3) | WB-STRAIN:WBStrain00034439 | WormBase (WB) | WB | available | PMID:1783292 | WB-STRAIN:SS262, CGC_SS262 | 2026-08-01 10:19:14 | 0 | ||
|
SRS329 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034431 | Caenorhabditis elegans | pha-1(e2123) III; lite-1(ce314) X; sraEx329. | sraEx329 [odr-2(18)p::chop-2(H134R)::TagRFP + odr-2(18)p::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in SMB in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of SMB causes the worm to turn in the same direction the head was bent when SMB was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431. | WBGene00001803(lite-1)|WBGene00004010(pha-1) | WBGene00001803(lite-1), WBGene00004010(pha-1) | WB-STRAIN:WBStrain00034431 | WormBase (WB) | WB | available | WB-STRAIN:SRS329, CGC_SRS329 | 2026-08-01 10:19:13 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
