Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00051830
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00020136(nlp-45)
Genomic Alteration: WBGene00020136(nlp-45)
Availability: unknown
References:
Synonyms: otEx7677; nlp-45(ot1046) X.
Alternate IDs:
Notes: otEx7677 [mgl-1p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Over-expression of nlp-45 in the RMDD/V neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
Proper citation: RRID:WB-STRAIN:WBStrain00051830 Copy
http://www.wormbase.org/db/get?name=WBStrain00051796
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006803(unc-70)
Genomic Alteration: WBGene00006803(unc-70)
Availability: unknown
References:
Synonyms: unc-70(mir6[loxP] mir16[loxP]) V.
Alternate IDs:
Notes: Made_by: Ravi Das|"Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987"
Proper citation: RRID:WB-STRAIN:WBStrain00051796 Copy
http://www.wormbase.org/db/get?name=WBStrain00051795
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16), WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: daf-16(hq389[daf-16::gfp::degron]) I; hqSi11 II; daf-2(e1370) unc-119(ed3) III.
Alternate IDs:
Notes: hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the gonadal sheath. hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051795 Copy
http://www.wormbase.org/db/get?name=WBStrain00051834
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: otIs669 V; otIs115.
Alternate IDs:
Notes: otIs115 [gcy-12p::GFP]. Integrated promoter fusion reporter for gcy-12. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https:|"otIs115 [gcy-12p::GFP]. Integrated promoter fusion reporter for gcy-12. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. References: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https:"
Proper citation: RRID:WB-STRAIN:WBStrain00051834 Copy
http://www.wormbase.org/db/get?name=WBStrain00051833
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: otTi71.
Alternate IDs:
Notes: otTi71 [UPN::lin-4::unc-54 3UTR]. single copy insertion of panneuronally expressed lin-4 pri-miRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
Proper citation: RRID:WB-STRAIN:WBStrain00051833 Copy
http://www.wormbase.org/db/get?name=WBStrain00051798
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: mirEx96.
Alternate IDs:
Notes: Made_by: Nawaphat Malaiwong|"mirEx96 [flp-22p::CRE + unc-122p::mCherry]. Pick animals with red fluorescence in coelomocytes to maintain the array. SMD-specific CRE driver. Superficially wild-type. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987"
Proper citation: RRID:WB-STRAIN:WBStrain00051798 Copy
http://www.wormbase.org/db/get?name=WBStrain00051836
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: unknown
References:
Synonyms: him-5(e1490)V; otIs518; otIs773.
Alternate IDs:
Notes: otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19.
Proper citation: RRID:WB-STRAIN:WBStrain00051836 Copy
http://www.wormbase.org/db/get?name=WBStrain00051835
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001867(him-8)|WBGene00020136(nlp-45)
Genomic Alteration: WBGene00001867(him-8), WBGene00020136(nlp-45)
Availability: unknown
References:
Synonyms: him-8(e1489) IV; nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X; otEx7578.
Alternate IDs:
Notes: otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
Proper citation: RRID:WB-STRAIN:WBStrain00051835 Copy
http://www.wormbase.org/db/get?name=WBStrain00051782
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: hqSi11 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Alternate IDs:
Notes: hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the gonadal sheath. hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051782 Copy
http://www.wormbase.org/db/get?name=WBStrain00051781
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: hqSi10 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Alternate IDs:
Notes: hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the body wall muscles. hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051781 Copy
http://www.wormbase.org/db/get?name=WBStrain00051780
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: hqSi9 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Alternate IDs:
Notes: hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the hypodermis. hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051780 Copy
http://www.wormbase.org/db/get?name=WBStrain00051786
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: ieSi57 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Alternate IDs:
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in somatic tissues. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051786 Copy
http://www.wormbase.org/db/get?name=WBStrain00051823
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: otIs763.
Alternate IDs:
Notes: otIs763 [lin-4(fosmid)::NLS::YFP::H2B]. Integrated fosmid transcriptional reporter for lin-4 microRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
Proper citation: RRID:WB-STRAIN:WBStrain00051823 Copy
http://www.wormbase.org/db/get?name=WBStrain00051789
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16), WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: daf-16(hq389[daf-16::gfp::degron]) I; hqSi8 II; daf-2(e1370) unc-119(ed3) III.
Alternate IDs:
Notes: hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3UTR+Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"
Proper citation: RRID:WB-STRAIN:WBStrain00051789 Copy
http://www.wormbase.org/db/get?name=WBStrain00051821
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: otIs748 X.
Alternate IDs:
Notes: otIs748 [rab-3p(prom1)::GFP + ttx-3p::mCherry] X. Pan-neuronal cytoplasmic GFP expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
Proper citation: RRID:WB-STRAIN:WBStrain00051821 Copy
http://www.wormbase.org/db/get?name=WBStrain00051787
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16)
Availability: unknown
References:
Synonyms: daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) III.
Alternate IDs:
Notes: Made_by: Yan-Ping Zhang, Wen-Hong Zhang|"Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:"
Proper citation: RRID:WB-STRAIN:WBStrain00051787 Copy
http://www.wormbase.org/db/get?name=WBStrain00051820
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: otIs653.
Alternate IDs:
Notes: Made_by: Maryam Majeed|"otIs653 [srg-8p::mCherry + cho-1p::mCherry + srg-8p::nlg-1::spGFP1-10 + cho-1p::nlg-1::spGFP11]. GRASP labeling of ASK to AIA synapses. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341"
Proper citation: RRID:WB-STRAIN:WBStrain00051820 Copy
http://www.wormbase.org/db/get?name=WBStrain00051825
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00020136(nlp-45)
Genomic Alteration: WBGene00020136(nlp-45)
Availability: unknown
References:
Synonyms: nlp-45(ot1047) X.
Alternate IDs:
Notes: Presumed null allele nlp-45. ot1047 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
Proper citation: RRID:WB-STRAIN:WBStrain00051825 Copy
http://www.wormbase.org/db/get?name=WBStrain00051824
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00020136(nlp-45)
Genomic Alteration: WBGene00020136(nlp-45)
Availability: unknown
References:
Synonyms: nlp-45(ot1046) X.
Alternate IDs:
Notes: Presumed null allele nlp-45. ot1046 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
Proper citation: RRID:WB-STRAIN:WBStrain00051824 Copy
http://www.wormbase.org/db/get?name=WBStrain00051828
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: otIs794.
Alternate IDs:
Notes: Made_by: Cyril Cros and Molly Reilly|"otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341"
Proper citation: RRID:WB-STRAIN:WBStrain00051828 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
