Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
otEx7677; nlp-45(ot1046) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051830 | Caenorhabditis elegans | otEx7677; nlp-45(ot1046) X. | otEx7677 [mgl-1p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Over-expression of nlp-45 in the RMDD/V neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. | WBGene00020136(nlp-45) | WBGene00020136(nlp-45) | WB-STRAIN:WBStrain00051830 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 | ||||
|
unc-70(mir6[loxP] mir16[loxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051796 | Caenorhabditis elegans | unc-70(mir6[loxP] mir16[loxP]) V. | Made_by: Ravi Das|"Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987" | WBGene00006803(unc-70) | WBGene00006803(unc-70) | WB-STRAIN:WBStrain00051796 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||
|
daf-16(hq389[daf-16::gfp::degron]) I; hqSi11 II; daf-2(e1370) unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051795 | Caenorhabditis elegans | daf-16(hq389[daf-16::gfp::degron]) I; hqSi11 II; daf-2(e1370) unc-119(ed3) III. | hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the gonadal sheath. hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang" | WBGene00000898(daf-2)|WBGene00000912(daf-16)|WBGene00006843(unc-119) | WBGene00000898(daf-2), WBGene00000912(daf-16), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051795 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
otIs669 V; otIs115. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051834 | Caenorhabditis elegans | otIs669 V; otIs115. | otIs115 [gcy-12p::GFP]. Integrated promoter fusion reporter for gcy-12. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https:|"otIs115 [gcy-12p::GFP]. Integrated promoter fusion reporter for gcy-12. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. References: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https:" | WB-STRAIN:WBStrain00051834 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 | ||||||
|
otTi71. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051833 | Caenorhabditis elegans | otTi71. | otTi71 [UPN::lin-4::unc-54 3UTR]. single copy insertion of panneuronally expressed lin-4 pri-miRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. | WB-STRAIN:WBStrain00051833 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 | ||||||
|
mirEx96. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051798 | Caenorhabditis elegans | mirEx96. | Made_by: Nawaphat Malaiwong|"mirEx96 [flp-22p::CRE + unc-122p::mCherry]. Pick animals with red fluorescence in coelomocytes to maintain the array. SMD-specific CRE driver. Superficially wild-type. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987" | WB-STRAIN:WBStrain00051798 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||||
|
him-5(e1490)V; otIs518; otIs773. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051836 | Caenorhabditis elegans | him-5(e1490)V; otIs518; otIs773. | otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19. | WBGene00001864(him-5) | WBGene00001864(him-5) | WB-STRAIN:WBStrain00051836 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 | ||||
|
him-8(e1489) IV; nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X; otEx7578. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051835 | Caenorhabditis elegans | him-8(e1489) IV; nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X; otEx7578. | otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. | WBGene00001867(him-8)|WBGene00020136(nlp-45) | WBGene00001867(him-8), WBGene00020136(nlp-45) | WB-STRAIN:WBStrain00051835 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||
|
hqSi11 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051782 | Caenorhabditis elegans | hqSi11 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. | hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the gonadal sheath. hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang" | WBGene00000898(daf-2)|WBGene00006843(unc-119) | WBGene00000898(daf-2), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051782 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
hqSi10 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051781 | Caenorhabditis elegans | hqSi10 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. | hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the body wall muscles. hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang" | WBGene00000898(daf-2)|WBGene00006843(unc-119) | WBGene00000898(daf-2), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051781 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||
|
hqSi9 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051780 | Caenorhabditis elegans | hqSi9 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. | hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the hypodermis. hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang" | WBGene00000898(daf-2)|WBGene00006843(unc-119) | WBGene00000898(daf-2), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051780 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
ieSi57 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051786 | Caenorhabditis elegans | ieSi57 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. | ieSi57 [eft-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in somatic tissues. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang" | WBGene00000898(daf-2)|WBGene00006843(unc-119) | WBGene00000898(daf-2), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051786 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
otIs763. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051823 | Caenorhabditis elegans | otIs763. | otIs763 [lin-4(fosmid)::NLS::YFP::H2B]. Integrated fosmid transcriptional reporter for lin-4 microRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. | WB-STRAIN:WBStrain00051823 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||||
|
daf-16(hq389[daf-16::gfp::degron]) I; hqSi8 II; daf-2(e1370) unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051789 | Caenorhabditis elegans | daf-16(hq389[daf-16::gfp::degron]) I; hqSi8 II; daf-2(e1370) unc-119(ed3) III. | hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3UTR+Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang" | WBGene00000898(daf-2)|WBGene00000912(daf-16)|WBGene00006843(unc-119) | WBGene00000898(daf-2), WBGene00000912(daf-16), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051789 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
otIs748 X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051821 | Caenorhabditis elegans | otIs748 X. | otIs748 [rab-3p(prom1)::GFP + ttx-3p::mCherry] X. Pan-neuronal cytoplasmic GFP expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341 | WB-STRAIN:WBStrain00051821 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 | ||||||
|
daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051787 | Caenorhabditis elegans | daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) III. | Made_by: Yan-Ping Zhang, Wen-Hong Zhang|"Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:" | WBGene00000898(daf-2)|WBGene00000912(daf-16) | WBGene00000898(daf-2), WBGene00000912(daf-16) | WB-STRAIN:WBStrain00051787 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||
|
otIs653. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051820 | Caenorhabditis elegans | otIs653. | Made_by: Maryam Majeed|"otIs653 [srg-8p::mCherry + cho-1p::mCherry + srg-8p::nlg-1::spGFP1-10 + cho-1p::nlg-1::spGFP11]. GRASP labeling of ASK to AIA synapses. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341" | WB-STRAIN:WBStrain00051820 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||||
|
nlp-45(ot1047) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051825 | Caenorhabditis elegans | nlp-45(ot1047) X. | Presumed null allele nlp-45. ot1047 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. | WBGene00020136(nlp-45) | WBGene00020136(nlp-45) | WB-STRAIN:WBStrain00051825 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 | ||||
|
nlp-45(ot1046) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051824 | Caenorhabditis elegans | nlp-45(ot1046) X. | Presumed null allele nlp-45. ot1046 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317. | WBGene00020136(nlp-45) | WBGene00020136(nlp-45) | WB-STRAIN:WBStrain00051824 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 | ||||
|
otIs794. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051828 | Caenorhabditis elegans | otIs794. | Made_by: Cyril Cros and Molly Reilly|"otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341" | WB-STRAIN:WBStrain00051828 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
