Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00051801

Source Database: WormBase (WB)
Affected Genes: WBGene00006670(twk-16)
Genomic Alteration: WBGene00006670(twk-16)
Availability: unknown
Source References: EMPTY
Synonyms: twk-16(syb2541[wrmScarlet::degron::twk-16]) X.
Notes: Made_by: Ravi Das|"wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987"

Proper citation: RRID:WB-STRAIN:WBStrain00051801 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051767

Source Database: WormBase (WB)
Affected Genes: WBGene00006910(vha-1)|WBGene00006917(vha-8)|WBGene00006920(vha-11)|WBGene00006921(vha-12)|WBGene00010130(vha-14)|WBGene00013025(vha-13)
Genomic Alteration: WBGene00006910(vha-1), WBGene00006917(vha-8), WBGene00006920(vha-11), WBGene00006921(vha-12), WBGene00010130(vha-14), WBGene00013025(vha-13)
Availability: unknown
Source References: EMPTY
Synonyms: vha-14(luc138) vha-1(luc132) III; vha-11(luc130) vha-8(luc135) IV; vha-13(luc133) V; vha-12(luc139) X.
Notes: Made_by: Paula Gutirrez-Prez|"vha gain-of-function alleles created by replacing the miR-1 binding sites (ACATTCCA) in the 3' UTRs of the endogenous loci with a NotI (GCGGCCGC) restriction site. (vha-12 gain-of-function allele was created by replacing three miR-1 binding sites (ACATTCCA) with NotI (GCGGCCGC), BamHI (GGATCC), and EcoRI (GAATTC) restriction sites.) Referred as 6x-vhaNotI. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."

Proper citation: RRID:WB-STRAIN:WBStrain00051767 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051766

Source Database: WormBase (WB)
Affected Genes: WBGene00006917(vha-8)
Genomic Alteration: WBGene00006917(vha-8)
Availability: unknown
Source References: EMPTY
Synonyms: vha-8(luc135) IV.
Notes: Made_by: Paula Gutirrez-Prez|"vha-8 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."

Proper citation: RRID:WB-STRAIN:WBStrain00051766 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051805

Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: unknown
Source References: EMPTY
Synonyms: nIs686 III; lin-15B&lin-15A(n765) X.
Notes: nIs686 [gpa-16p::GCaMP3::unc-54 3' UTR + lin-15(+)] III. Expression of GCaMP in RIP, pharyngeal muscle (pm2, pm3, and dimly/occasionally in pm1), mc1 marginal cells, and other unidentified cells. Derived by gamma-irradiation of nEx2309 in parental strain MT23222 and out-crossed five times to MT8189 lin-15B&lin-15A(n765). Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341

Proper citation: RRID:WB-STRAIN:WBStrain00051805 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051804

Source Database: WormBase (WB)
Affected Genes: WBGene00003004(lin-15)
Genomic Alteration: WBGene00003004(lin-15)
Availability: unknown
Source References: EMPTY
Synonyms: nIs348 IV; lin-15AB(n765) X.
Notes: nIs348 [ceh-28p::4XNLS::mCherry + lin-15(+)] IV. Reporter construct contains 2.4 kb of ceh-28 promoter. Reference: Hirose T, et al. Proc Natl Acad Sci. 2010 Aug 31;107(35):15479-84. PMID: 20713707

Proper citation: RRID:WB-STRAIN:WBStrain00051804 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051769

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006910(vha-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006910(vha-1)
Availability: unknown
Source References: EMPTY
Synonyms: vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III).
Notes: Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"Made_by: Paula Gutirrez-Prez"

Proper citation: RRID:WB-STRAIN:WBStrain00051769 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051802

Source Database: WormBase (WB)
Affected Genes: WBGene00006616(trp-4)
Genomic Alteration: WBGene00006616(trp-4)
Availability: unknown
Source References: EMPTY
Synonyms: trp-4(mir35mir36[trp-4::gfp]) I.
Notes: GFP tag inserted into the N-terminus of the endogenous trp-4 locus using a two-step nested CRISPR method. The GFP signal is more prominent on the tip of the nose of the animals. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987|"Made_by: Ravi Das"

Proper citation: RRID:WB-STRAIN:WBStrain00051802 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051808

Source Database: WormBase (WB)
Affected Genes: WBGene00003387(mod-5)
Genomic Alteration: WBGene00003387(mod-5)
Availability: unknown
Source References: EMPTY
Synonyms: mod-5(vlc47[mod-5::T2A::mNeonGreen]) I.
Notes: Made_by: Carlos Mora-Martnez|"mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334"

Proper citation: RRID:WB-STRAIN:WBStrain00051808 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051807

Source Database: WormBase (WB)
Affected Genes: WBGene00001803(lite-1)|WBGene00004510(rrf-3)
Genomic Alteration: WBGene00001803(lite-1), WBGene00004510(rrf-3)
Availability: unknown
Source References: EMPTY
Synonyms: rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292.
Notes: Made_by: ngela Jimeno|"vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334"

Proper citation: RRID:WB-STRAIN:WBStrain00051807 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051756

Source Database: WormBase (WB)
Affected Genes: WBGene00001170(egl-1)
Genomic Alteration: WBGene00001170(egl-1)
Availability: unknown
Source References: EMPTY
Synonyms: egl-1(cdb97) V.
Notes: Brood size slightly reduced at 25 degrees. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Proper citation: RRID:WB-STRAIN:WBStrain00051756 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051755

Source Database: WormBase (WB)
Affected Genes: WBGene00003263(mir-35)
Genomic Alteration: WBGene00003263(mir-35)
Availability: unknown
Source References: EMPTY
Synonyms: mir-35(cdb2 cdb4) II.
Notes: Made_by: Bridget Donnelly|"Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039"

Proper citation: RRID:WB-STRAIN:WBStrain00051755 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051754

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: wIs51 V; icbSi2.
Notes: Made_by: Mark Hintze|"wIs51 [SCMp::GFP + unc-119(+)]. icbSi2 [dpy-7p::mCherry::H2B::unc-54 + Cbr-unc-119(+)]. Seam cell nuclei labelled with GFP. hyp7 nuclei labelled with mCherry. Reference: Hintze M, et al. Genetics. 2020 Apr;214(4):927-939. doi: 10.1534/genetics.119.302896. PMID: 31988193."

Proper citation: RRID:WB-STRAIN:WBStrain00051754 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051742

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: kasIs7.
Notes: kasIs7 [snb-1p::C9 ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: https:|"Made_by: Yoshifumi Sonobe"

Proper citation: RRID:WB-STRAIN:WBStrain00051742 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051746

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: kasEx161.
Notes: kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821|"kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821"|"Made_by: Yoshifumi Sonobe"

Proper citation: RRID:WB-STRAIN:WBStrain00051746 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051745

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: kasEx159.
Notes: kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821|"kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821"|"Made_by: Yoshifumi Sonobe"

Proper citation: RRID:WB-STRAIN:WBStrain00051745 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051743

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: kasIs9.
Notes: kasIs9 [snb-1p::(delta)C9 ubi + myo-2::GFP]. The transgene has the snb-1 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: https:|"Made_by: Yoshifumi Sonobe"

Proper citation: RRID:WB-STRAIN:WBStrain00051743 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051748

Source Database: WormBase (WB)
Affected Genes: WBGene00002263(lea-1)|WBGene00003514(myo-2)
Genomic Alteration: WBGene00002263(lea-1), WBGene00003514(myo-2)
Availability: unknown
Source References: EMPTY
Synonyms: lea-1(cp423[myo-2p::GFP::myo-2 3'UTR]) V.
Notes: Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234

Proper citation: RRID:WB-STRAIN:WBStrain00051748 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051747

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: kasIs10.
Notes: kasIs10 [snb-1p::UAG ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821|"Made_by: Yoshifumi Sonobe"

Proper citation: RRID:WB-STRAIN:WBStrain00051747 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051739

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: peIs422.
Notes: peIs422 [gcy-5p::Downward DAG2(worm) + gcy-5p::mCherry + unc-122p::mCherry]. Transgene allows imaging of changes in the amount of diacylglycerol (DAG) in ASER neuron. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465

Proper citation: RRID:WB-STRAIN:WBStrain00051739 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051793

Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) unc-119(ed3) III; ieSi38 IV.
Notes: ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the germ line. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00051793 Copy   

•   Source: Integrated Animals