Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00051701

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002010(hsp-6)
Genomic Alteration: WBGene00002010(hsp-6)
Availability: unknown
References:
Synonyms: hsp-6(mg585) V; mgIs73 V.
Alternate IDs:
Notes: Made_by: Ruvkun|"mgIs73 [cyp-14A4p::GFP::cyp-14A4 3UTR + myo-2p::mCherry] V. Slow growth. Low brood size. Received as a replacement for GR2249. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1."

Proper citation: RRID:WB-STRAIN:WBStrain00051701 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051667

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00019953(wapl-1)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00019953(wapl-1)
Availability: unknown
References:
Synonyms: xpf-1(e1487) II; unc-24(e138) wapl-1(t1773)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V.
Alternate IDs:
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1773 homozygotes that do not produce viable progeny. GE2153 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1773 homozygotes that do not produce viable progeny. GE2153 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."

Proper citation: RRID:WB-STRAIN:WBStrain00051667 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051700

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000485(che-3)
Genomic Alteration: WBGene00000485(che-3)
Availability: unknown
References:
Synonyms: che-3(cas528[gfp::che-3(R1384C)]) I.
Alternate IDs:
Notes: GFP inserted into the endogenous che-3 gene at its N-terminus and R1384C mutation introduced by Cas9-triggered homologous recombination. Lipophilic dye filling is superficially wild-type and the amphid and phasmid sensory cilia are mildly shortened without evident IFT particle accumulation.

Proper citation: RRID:WB-STRAIN:WBStrain00051700 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051666

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00013024(cept-2)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00013024(cept-2)
Availability: unknown
References:
Synonyms: xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) cept-2(t2007)/nt1[let (m435)] V.
Alternate IDs:
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2007 homozygotes that produce dead eggs. GE2122 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2007 homozygotes that produce dead eggs. GE2122 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."

Proper citation: RRID:WB-STRAIN:WBStrain00051666 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051705

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00012802(set-25)|WBGene00019883(met-2)
Genomic Alteration: WBGene00012802(set-25), WBGene00019883(met-2)
Availability: unknown
References:
Synonyms: met-2(n4256) set-25(n5021) III; gwIs4 X.
Alternate IDs:
Notes: gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621|"Made_by: Benjamin Towbin"

Proper citation: RRID:WB-STRAIN:WBStrain00051705 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051704

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000123(ama-1)|WBGene00001074(dpy-13)
Genomic Alteration: WBGene00000123(ama-1), WBGene00001074(dpy-13)
Availability: unknown
References:
Synonyms: gwIs39 III; dpy-13(eI84) ama-1(m118m251) IV; gwIs58.
Alternate IDs:
Notes: gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Slow growing and dumpy. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676

Proper citation: RRID:WB-STRAIN:WBStrain00051704 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051709

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: xeSi302 II; gwIs114.
Alternate IDs:
Notes: xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.

Proper citation: RRID:WB-STRAIN:WBStrain00051709 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051708

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000415(ced-1)|WBGene00002989(lim-7)|WBGene00003004(lin-15)|WBGene00012802(set-25)|WBGene00019883(met-2)
Genomic Alteration: WBGene00000415(ced-1), WBGene00002989(lim-7), WBGene00003004(lin-15), WBGene00012802(set-25), WBGene00019883(met-2)
Availability: unknown
References:
Synonyms: met-2(n4256) set-25(n5021) III; bcIs39 [lim-7p::ced-1::GFP + lin-15(+)] V.
Alternate IDs:
Notes: Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. CED-1::GFP used to detect apoptotic cells in germline. Reference: Zeller P, et al. Nat Genet. 2016 Nov;48(11):1385-1395. doi: 10.1038/ng.3672. PMID: 27668659.

Proper citation: RRID:WB-STRAIN:WBStrain00051708 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051775

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: unknown
References:
Synonyms: daf-2(hq61[daf-2::mNeongreen]) III.
Alternate IDs:
Notes: Made_by: Yan-Ping Zhang, Wen-Hong Zhang|"mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. Phenotypic assays have shown that this mNeonGreen tag does not perturb the function of the DAF-2 protein. DAF-2::mNeonGreen is expressed in neurons, XXX cells, vulval cells, germ cells, and oocytes with clear plasma membrane localization as expected for a cell surface receptor. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:"

Proper citation: RRID:WB-STRAIN:WBStrain00051775 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051773

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00015776(dct-1)
Genomic Alteration: WBGene00015776(dct-1)
Availability: unknown
References:
Synonyms: dct-1(luc194) X.
Alternate IDs:
Notes: CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"CRISPR/Cas9-engineered deletion removes the entire dct-t coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."|"Made_by: Paula Gutirrez-Prez"

Proper citation: RRID:WB-STRAIN:WBStrain00051773 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051772

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: oxIs322 II; unc-119(ed3) III; lucEx1311.
Alternate IDs:
Notes: Made_by: Paula Gutirrez-Prez|"oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. lucEx1311 (myo-3p::R2pH::LAMP1::3xFLAG::unc-54 3UTR + ttx-3p::mCherry). Pick mCherry+ to maintain. Reference: Gutierrez-Perez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."

Proper citation: RRID:WB-STRAIN:WBStrain00051772 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051779

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; ieSi38 IV.
Alternate IDs:
Notes: ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00051779 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051778

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: ieSi61 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Alternate IDs:
Notes: ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00051778 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051777

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000898(daf-2), WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: hqSi8 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III.
Alternate IDs:
Notes: hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3UTR+Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00051777 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051815

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00016421(cdc-7)
Genomic Alteration: WBGene00016421(cdc-7)
Availability: unknown
References:
Synonyms: cdc-7(knu709) I.
Alternate IDs:
Notes: CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.

Proper citation: RRID:WB-STRAIN:WBStrain00051815 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051813

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: zdIs13 IV; vlcEx1290.
Alternate IDs:
Notes: zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

Proper citation: RRID:WB-STRAIN:WBStrain00051813 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051818

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: jsSi1669 IV.
Alternate IDs:
Notes: jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3 rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site.

Proper citation: RRID:WB-STRAIN:WBStrain00051818 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051817

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: jsSi1579 II; bqSi711 IV.
Alternate IDs:
Notes: jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.

Proper citation: RRID:WB-STRAIN:WBStrain00051817 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051762

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006920(vha-11)
Genomic Alteration: WBGene00006920(vha-11)
Availability: unknown
References:
Synonyms: vha-11(luc130) IV.
Alternate IDs:
Notes: Made_by: Paula Gutirrez-Prez|"vha-11 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644."

Proper citation: RRID:WB-STRAIN:WBStrain00051762 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051761

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: lucEx421.
Alternate IDs:
Notes: lucEx421 [mir-4813p::myr::GFP::unc-54 3UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Reporter contains 1kb upstream mir-4813 promoter sequence and 1kb unc-54 3UTR downstream sequence. Provides a marker for pharyngeal muscle cell-cell fusion. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"Made_by: Thomas Steinacker"

Proper citation: RRID:WB-STRAIN:WBStrain00051761 Copy   

•   Source: Integrated Animals