Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ral-1(re218[mKate2::3xFlag::ral-1]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051649 | Caenorhabditis elegans | ral-1(re218[mKate2::3xFlag::ral-1]) III. | Made_by: Hanna Shin|"Ubiquitous expression and localization to plasma membranes. Derived in an N2 background. TD185 5 -GCCGGAAGAGTGATGAACCC- 3 TD186 5 -TAATGAGCTCGGAGACCATGGC- 3TD187 5 -CGCACCTCATCATACATGAACTGC- 3 Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501" | WBGene00021811(ral-1) | WBGene00021811(ral-1) | WB-STRAIN:WBStrain00051649 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:47 | 0 | ||||
|
wrdSi23 I; unc-104(knu973[unc-104::AID]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051639 | Caenorhabditis elegans | wrdSi23 I; unc-104(knu973[unc-104::AID]) II. | Made_by: Cori K. Cahoon|"Supplementary_genotype wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I; unc-104(knu973[unc-104::AID]) II"|"wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https:" | WBGene00006831(unc-104) | WBGene00006831(unc-104) | WB-STRAIN:WBStrain00051639 | WormBase (WB) | WB | unknown | PMID:37651423 | 2026-08-01 10:23:39 | 0 | |||
|
ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051690 | Caenorhabditis elegans | ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. | Made_by: Anita Rhodes (Glow Worms '20)|"N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38." | WBGene00014204(ccdc-47) | WBGene00014204(ccdc-47) | WB-STRAIN:WBStrain00051690 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
hsp-4(utx39[hsp-4::mNG::3xFlag]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051694 | Caenorhabditis elegans | hsp-4(utx39[hsp-4::mNG::3xFlag]) II. | C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.|"Made_by: Quincy Martin (Glow Worms '21)" | WBGene00002008(hsp-4) | WBGene00002008(hsp-4) | WB-STRAIN:WBStrain00051694 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:47 | 0 | ||||
|
ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051693 | Caenorhabditis elegans | ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III | C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.|"Made_by: Dan Tatulescu (Glow Worms '21)" | WB-STRAIN:WBStrain00051693 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||||
|
edc-3(utx35[mNG::3xFlag::edc-3]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051692 | Caenorhabditis elegans | edc-3(utx35[mNG::3xFlag::edc-3]) I. | Made_by: Diya Sharma (Glow Worms '21)|"N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42." | WBGene00011036(edc-3) | WBGene00011036(edc-3) | WB-STRAIN:WBStrain00051692 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051691 | Caenorhabditis elegans | nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. | Made_by: Gillian Witten (Glow Worms '21)|"N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40." | WBGene00003607(nhr-8) | WBGene00003607(nhr-8) | WB-STRAIN:WBStrain00051691 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:47 | 0 | ||||
|
sod-2(utx53[mScarlet::3xMyc::sod-2]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051698 | Caenorhabditis elegans | sod-2(utx53[mScarlet::3xMyc::sod-2]) I. | Made_by: Param Kapoor (Glow Worms '21)|"N-terminal tag of SOD-2 via CRISPR/Cas9 knock-in of mScarlet at sod-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' attgaatattttaattatttgcagccgaaa 3'; Right flank: 5' ATGCTTCAAAACACGGTTCGCTGTGTCTCA 3 (1 silent mutation); sgRNA: AAGCTTTGAGACACAGCGAA; Cas9/sgRNA plasmid: pGLOW98; mScarlet^SEC^3xMyc plasmid: pGLOW111; SEC insertion allele strain: GLW64." | WBGene00004931(sod-2) | WBGene00004931(sod-2) | WB-STRAIN:WBStrain00051698 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
pqn-59(utx51[mNG::3xFlag::pqn-59]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051697 | Caenorhabditis elegans | pqn-59(utx51[mNG::3xFlag::pqn-59]) I. | Made_by: Persephone Alicea (Glow Worms '20)|"N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3 (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62." | WBGene00004143(pqn-59) | WBGene00004143(pqn-59) | WB-STRAIN:WBStrain00051697 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:47 | 0 | ||||
|
egl-30(pe914) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051730 | Caenorhabditis elegans | egl-30(pe914) I. | Presumptive gain-of-function mutant shows defects in salt-food associative learning and olfactory learning. Reference: Tomioka M, et al. 2006 Sep 7;51(5):613-25. PMID: 16950159 | WBGene00001196(egl-30) | WBGene00001196(egl-30) | WB-STRAIN:WBStrain00051730 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:47 | 0 | ||||
|
asp-3(utx47[mNG::3xFlag::asp-3]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051696 | Caenorhabditis elegans | asp-3(utx47[mNG::3xFlag::asp-3]) X. | Made_by: Stephen Pullman (Glow Worms '21)|"N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58." | WBGene00000216(asp-3) | WBGene00000216(asp-3) | WB-STRAIN:WBStrain00051696 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
daf-2(pe1230) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051735 | Caenorhabditis elegans | daf-2(pe1230) III. | Daf-c phenotype at 25C; normal development at 20C. Defects in salt-starve associative learning and olfactory learning. Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490 | WBGene00000898(daf-2) | WBGene00000898(daf-2) | WB-STRAIN:WBStrain00051735 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
daf-18(pe408) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051734 | Caenorhabditis elegans | daf-18(pe408) IV. | pe408 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490 | WBGene00000913(daf-18) | WBGene00000913(daf-18) | WB-STRAIN:WBStrain00051734 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
klp-20(cas447[klp-20::gfp]) III; xbx-1(cas502[xbx-1::tagRFP]) V; ift-81(cas498[ift-81::tagBFP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051699 | Caenorhabditis elegans | klp-20(cas447[klp-20::gfp]) III; xbx-1(cas502[xbx-1::tagRFP]) V; ift-81(cas498[ift-81::tagBFP]) X. | Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons. | WBGene00002230(klp-20)|WBGene00006960(xbx-1)|WBGene00017973(ift-81) | WBGene00002230(klp-20), WBGene00006960(xbx-1), WBGene00017973(ift-81) | WB-STRAIN:WBStrain00051699 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
plc-1(pe1238) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051732 | Caenorhabditis elegans | plc-1(pe1238) X. | Made_by: Iwata R.|"Presumptive null allele of plc-1. Shows a preference for low salt concentrations. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210." | WBGene00004036(plc-1) | WBGene00004036(plc-1) | WB-STRAIN:WBStrain00051732 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
peIs2113. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051737 | Caenorhabditis elegans | peIs2113. | Made_by: Jang Moon Sun|"peIs2113 [gcy-21p::mCaspase + tax-4p::NLS::YC2.60 + lin-44p::GFP]. Genetic ablation of ASG neurons by specific expression of caspase. tax-4p::YC2.60 facilitates calcium imaging. Reference: Jang MS, et al. Proc Natl Acad Sci U S A. 2019 Sep 10;116(37):18673-18683. PMID: 31455735" | WB-STRAIN:WBStrain00051737 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||||
|
xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2055)/nt1[let (m435)] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051683 | Caenorhabditis elegans | xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2055)/nt1[let (m435)] V. | him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2055 homozygotes that produce unfertilized oocytes. GE2886 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2055 homozygotes that produce unfertilized oocytes. GE2886 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9." | WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00008346(C56A3.8) | WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00008346(C56A3.8) | WB-STRAIN:WBStrain00051683 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
xpf-1(e1487) II; unc-24(e138) T22B11.1(t1786)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051682 | Caenorhabditis elegans | xpf-1(e1487) II; unc-24(e138) T22B11.1(t1786)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. | him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1786 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2827 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1786 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2827 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9." | WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00020675(spe-51) | WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00020675(spe-51) | WB-STRAIN:WBStrain00051682 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:47 | 0 | ||||
|
xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2029)/nt1[let (m435)] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051681 | Caenorhabditis elegans | xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2029)/nt1[let (m435)] V. | him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9." | WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00008346(C56A3.8) | WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00008346(C56A3.8) | WB-STRAIN:WBStrain00051681 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 | ||||
|
muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051686 | Caenorhabditis elegans | muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. | Made_by: Ella DeMott (Glow Worms '20)|"muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26" | WBGene00001946(his-72)|WBGene00006843(unc-119) | WBGene00001946(his-72), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051686 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:40 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
