Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
mir-47(umn55[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272])I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051621 | Caenorhabditis elegans | mir-47(umn55[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272])I. | mir-47 pre-miRNA deletion allele in which mir-47 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.] | WBGene00003275(mir-47)|WBGene00003514(myo-2)|WBGene00005016(sqt-1) | WBGene00003275(mir-47), WBGene00003514(myo-2), WBGene00005016(sqt-1) | WB-STRAIN:WBStrain00051621 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
bqSi294 II; bqSi852 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051587 | Caenorhabditis elegans | bqSi294 II; bqSi852 IV. | bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi852 [ckb-3p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the somatic gonad and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the somatic gonad can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https: | WB-STRAIN:WBStrain00051587 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:38 | 0 | ||||||
|
mir-1818(umn54[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272])I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051620 | Caenorhabditis elegans | mir-1818(umn54[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272])I. | mir-1818 pre-miRNA deletion allele in which mir-1818 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.] | WBGene00003514(myo-2)|WBGene00005016(sqt-1)|WBGene00077715(mir-1818) | WBGene00003514(myo-2), WBGene00005016(sqt-1), WBGene00077715(mir-1818) | WB-STRAIN:WBStrain00051620 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
bqSi189 II; mel-28(bq17 [g>f>p::mel-28]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051586 | Caenorhabditis elegans | bqSi189 II; mel-28(bq17 [g>f>p::mel-28]) III. | bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous mel-28 inserted by CRISPR/Cas9 after the mel-28 start codon. FRT sites in GFP introns 2 & 3 are indicated by > symbols in genotype. Ubiquitous expression of mCherry::HIS-58. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https: | WBGene00003210(mel-28) | WBGene00003210(mel-28) | WB-STRAIN:WBStrain00051586 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:46 | 0 | ||||
|
mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051625 | Caenorhabditis elegans | mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. | Made_by: Julie Knott & Marcus Vargas|"Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG." | WBGene00002957(let-858)|WBGene00003039(mir-48) | WBGene00002957(let-858), WBGene00003039(mir-48) | WB-STRAIN:WBStrain00051625 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:46 | 0 | ||||
|
bqSi294 II; bqSi1021 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051589 | Caenorhabditis elegans | bqSi294 II; bqSi1021 IV. | bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1021 [lin-31p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in P1.p-P11.p and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in P1.p-P11.p can mask GFP::HIS-58 signal. May carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https: | WB-STRAIN:WBStrain00051589 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:46 | 0 | ||||||
|
acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051570 | Caenorhabditis elegans | acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. | acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.|"Made_by: Lauren Booth" | WBGene00009073(delm-1)|WBGene00016063(delm-2)|WBGene00016064(acd-1) | WBGene00009073(delm-1), WBGene00016063(delm-2), WBGene00016064(acd-1) | WB-STRAIN:WBStrain00051570 | WormBase (WB) | WB | unknown | PMID:37118502 | 2026-08-01 10:23:38 | 0 | |||
|
unc-119(ed3) III; kstSi37 IV; kstEx46. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051614 | Caenorhabditis elegans | unc-119(ed3) III; kstSi37 IV; kstEx46. | kstSi37 [Cbr-unc-119(kst13)] IV. kstEx46 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051614 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
kstSi84 I; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051612 | Caenorhabditis elegans | kstSi84 I; unc-119(ed3) III. | kstSi84 [LoxP + Cbr-unc-119(+) + LoxP + mlc-2p::GFP(kst32)] I. N2-like, no MLC-2::GFP fluorescence. mlc-2p::GFP(kst32) is a partial, non-functional GFP reporter used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051612 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
mjIs134 II; meg-3(tm4259) meg-4(ax2026) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051578 | Caenorhabditis elegans | mjIs134 II; meg-3(tm4259) meg-4(ax2026) X. | Made_by: Itai Toker|"mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Germ granule defective. ~30% sterility, maintain by picking gravid adults with visible embryos. Nuclear GFP expression in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614" | WBGene00001569(meg-3)|WBGene00016485(meg-4) | WBGene00001569(meg-3), WBGene00016485(meg-4) | WB-STRAIN:WBStrain00051578 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:38 | 0 | ||||
|
kstSi61 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051611 | Caenorhabditis elegans | kstSi61 II; unc-119(ed3) III. | kstSi61 [LoxP + Cbr-unc-119(+) + LoxP + hygroR(kst31)] II. N2-like, no hygromycin resistance (HygroR). hygroR(kst31) is a partial, non-functional hygromycin-resistance construct used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051611 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051617 | Caenorhabditis elegans | mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. | Made_by: Marcus Vargas & Julie Knott|"Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG." | WBGene00001182(egl-13)|WBGene00002957(let-858)|WBGene00003335(mir-241) | WBGene00001182(egl-13), WBGene00002957(let-858), WBGene00003335(mir-241) | WB-STRAIN:WBStrain00051617 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
pqn-59::ollas::STOP(cz2) Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051561 | Caenorhabditis elegans | pqn-59::ollas::STOP(cz2) | Batch Strain object requested via get_NS_ids.pl | WBGene00004143(pqn-59) | WBGene00004143(pqn-59) | WB-STRAIN:WBStrain00051561 | WormBase (WB) | WB | unknown | PMID:34661238 | 2026-08-01 10:23:38 | 0 | |||
|
ldIs7[skn-1b/c::GFP; rol-6(su1006)] Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051566 | Caenorhabditis elegans | ldIs7[skn-1b/c::GFP; rol-6(su1006)] | [2022-05-02T21:36:56.545Z WBPerson712] New Strain: lsIs7[skn-1b/c::GFP + rol-6(su1006)]|"[2022-05-02T21:39:29.432Z WBPerson712] Kill Strain: typo in genotype"|"[2022-05-02T21:40:28.377Z WBPerson712] Ressurect Strain: yes, genotype should be ldIs7[skn-1b/c::GFP; rol-6(su1006)]" | WB-STRAIN:WBStrain00051566 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:38 | 0 | ||||||
|
(Pdat-1::GFP; Pdat-1::alpha-synuclein) Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051565 | Caenorhabditis elegans | (Pdat-1::GFP; Pdat-1::alpha-synuclein) | [2022-04-21T22:26:42.385Z WBPerson324] New Strain: WBPaper00061894; Genotype: (Pdat-1::GFP; Pdat-1::alpha-synuclein) | WB-STRAIN:WBStrain00051565 | WormBase (WB) | WB | unknown | PMID:34496255 PMID:39149885 |
2026-08-01 10:23:46 | 0 | |||||
|
Cbr-dpy-10(ot1210) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051563 | Caenorhabditis briggsae | Cbr-dpy-10(ot1210) II. | Dpy Rol. Heterozygotes are Left-handed Rol. R92C mutation in Cbr-dpy-10 generated via CRISPR/Cas9. Homologous to the C. elegans dpy-10(cn64) mutation.|"Made_by: Itai Toker"|"[2022-04-14T16:23:26.123Z WBPerson712] New Strain: 10.17912/micropub.biology.000554. Cbr-dpy-10(ot1210) II" | WBGene00001072(dpy-10)|WBGene00032386(Cbr-dpy-10) | WBGene00001072(dpy-10), WBGene00032386(Cbr-dpy-10) | WB-STRAIN:WBStrain00051563 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:38 | 0 | ||||
|
N2_q71 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051567 | Caenorhabditis elegans | EMPTY | [2022-05-05T15:26:01.821Z WBPerson712] New Strain: WBPaper00064018 Caenorhabditis elegans fog-2(q71) Generated through introgression of fog-2(q71) mutation from JK574 strain to N2 genetic background. Available at the Jagiellonian University, Institute of Environmental Sciences | WB-STRAIN:WBStrain00051567 | WormBase (WB) | WB | unknown | PMID:35601754 | 2026-08-01 10:23:38 | 0 | |||||
|
air-2(ie31[degron::GFP::air-2]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051600 | Caenorhabditis elegans | air-2(ie31[degron::GFP::air-2]) I. | Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923|"GFP::AIR-2 endogenous tag" | WBGene00000099(air-2) | WBGene00000099(air-2) | WB-STRAIN:WBStrain00051600 | WormBase (WB) | WB | unknown | PMID:37039075 | 2026-08-01 10:23:38 | 0 | |||
|
glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051606 | Caenorhabditis elegans | glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. | fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https: | WBGene00001423(fib-1)|WBGene00001598(glh-1) | WBGene00001423(fib-1), WBGene00001598(glh-1) | WB-STRAIN:WBStrain00051606 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
kstSi32 I; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051608 | Caenorhabditis elegans | kstSi32 I; unc-119(ed3) III. | kstSi32 [Cbr-unc-119(kst13)] I. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051608 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
