Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
nep-8(gk5859[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051456 | Caenorhabditis elegans | nep-8(gk5859[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 2935 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGAAAGTGAAAGAGAAGCTCTCTAGGCCT. Right flanking sequence: aggttcatccggcgacgacaaaaaatctaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017553(nep-8) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017553(nep-8) | WB-STRAIN:WBStrain00051456 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
rpb-11(gk5858[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051455 | Caenorhabditis elegans | rpb-11(gk5858[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 413 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATCATTTTTGCTTCTCGACGACAAGAAATT. Right flanking sequence: AACTGATTTTTCACTTTTTCCTTACTGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00012187(rpb-11) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00012187(rpb-11) | WB-STRAIN:WBStrain00051455 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
best-24(gk5857[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051454 | Caenorhabditis elegans | best-24(gk5857[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 3283 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACAACTTAGCAGTATCCACTTCAAAACCG. Right flanking sequence: GAGAAACTACCCGATCCACCCGACCACAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022797(best-24) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022797(best-24) | WB-STRAIN:WBStrain00051454 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:45 | 0 | ||||
|
Y71G12B.13(gk5855[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051453 | Caenorhabditis elegans | Y71G12B.13(gk5855[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CACTGCAACAATCGCAATTTTCAGACAATT. Right flanking sequence: CGGAGCCTGTGCAATTCCATGTGGGAAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051453 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
grd-4(gk5861[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051458 | Caenorhabditis elegans | grd-4(gk5861[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 890 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: gcaatacaacgaagtcatctaaagtgttca. Right flanking sequence: tgtgtgtttttgagaggataaaaagaaaca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00001693(grd-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001693(grd-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051458 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
C50F2.2(gk5846[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051444 | Caenorhabditis elegans | C50F2.2(gk5846[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4481 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TACCATCAGTTCATGAGAATGCCTACCAAG. Right flanking sequence: ACTGGAATTATGGCACAGATTATGAGGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051444 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
taf-2(gk5844[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051442 | Caenorhabditis elegans | taf-2(gk5844[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 8143 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGCCTCGTATCCACTATTATGCCACTGTGA. Right flanking sequence: CGTTCAGCGTCACTTTGCTCGCCGAGCCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006383(taf-2)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006383(taf-2), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051442 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:45 | 0 | ||||
|
Y65B4A.8(gk5849[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051447 | Caenorhabditis elegans | Y65B4A.8(gk5849[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3386 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACGGTCCACGTTTCGGCGAGCGTTTTGTG. Right flanking sequence: CGGCTGCGCGTCTCTATTTCACACACTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051447 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
ints-2(gk5848[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051446 | Caenorhabditis elegans | ints-2(gk5848[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5928 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGGAAAGAAAGAAAAATTACTTCGAGATTG. Right flanking sequence: TGGAATGTTGGCTGGAGATCCACGACATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013877(ints-2) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013877(ints-2) | WB-STRAIN:WBStrain00051446 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
vha-20(gk5840[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051438 | Caenorhabditis elegans | vha-20(gk5840[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1452 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTAGACGGTTATCAAGTTTTTATGAAACCA. Right flanking sequence: AACTTCATCCTGAAATTGATTGATTGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010993(vha-20) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010993(vha-20) | WB-STRAIN:WBStrain00051438 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
frpr-17(sy1302) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051539 | Caenorhabditis elegans | frpr-17(sy1302) X. | Batch Strain object requested via get_NS_ids.pl|"Made_by: Heenam Park & Mandy Tan"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-17. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCAGTTAATCAGTCATGATATTATCGATCCAAGCT right flanking sequence: CAGTGGGATTTCAAAACTGTGAACCTTTGgtgag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTATCGATCCAAGCTCAG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00011765(frpr-17) | WBGene00011765(frpr-17) | WB-STRAIN:WBStrain00051539 | WormBase (WB) | WB | unknown | PMID:34741504 | 2026-08-01 10:23:38 | 0 | |||
|
frpr-14(sy1301) Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051538 | Caenorhabditis elegans | frpr-14(sy1301) | Batch Strain object requested via get_NS_ids.pl | WBGene00019496(frpr-14) | WBGene00019496(frpr-14) | WB-STRAIN:WBStrain00051538 | WormBase (WB) | WB | unknown | PMID:34741504 | 2026-08-01 10:23:46 | 0 | |||
|
bqSi1030 II; bqSi508 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051593 | Caenorhabditis elegans | bqSi1030 II; bqSi508 IV. | bqSi1030 [hsp16.41p::FRT::mCherry::his-58::FRT::vhhGFP4::zif-1 + unc-119(+)] II. bqSi508 [elt-2p::FLP + unc-119(+)] IV. Can be used for inducible degradation of GFP fusion proteins in intestinal cells. May carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https: | WB-STRAIN:WBStrain00051593 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||||
|
bqSi1030 II; bqSi548 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051592 | Caenorhabditis elegans | bqSi1030 II; bqSi548 IV. | bqSi1030 [hsp16.41p::FRT::mCherry::his-58::FRT::vhhGFP4::zif-1 + unc-119(+)] II. bqSi548 [dpy-7p::FLP + unc-119(+)] IV. Can be used for inducible degradation of GFP fusion proteins in hypodermal cell. May carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https: | WB-STRAIN:WBStrain00051592 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:46 | 0 | ||||||
|
ieSi64 II; lag-1(oz536oz537[lag-1::degron::3xHA]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051599 | Caenorhabditis elegans | ieSi64 II; lag-1(oz536oz537[lag-1::degron::3xHA]) IV. | ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https:|"Made_by: Jian Chen" | WBGene00002245(lag-1) | WBGene00002245(lag-1) | WB-STRAIN:WBStrain00051599 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
bqSi294 II; bqSi1308 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051596 | Caenorhabditis elegans | bqSi294 II; bqSi1308 IV. | bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1308 [hlh-12p::FLP::SL2::mTagBFP2 + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the distal tip cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mTagBFP2 in the distal tip cells. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https: | WB-STRAIN:WBStrain00051596 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||||
|
juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051636 | Caenorhabditis elegans | juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. | juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. RFP expression in AIY neuron. Weak light green signals were observed in the neurons using compound scope although this is only the former half of the split GFP. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.|"Made_by: Ken Noma" | WBGene00006654(ttx-3)|WBGene00009100(rgef-1) | WBGene00006654(ttx-3), WBGene00009100(rgef-1) | WB-STRAIN:WBStrain00051636 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||
|
rjSi1 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051635 | Caenorhabditis elegans | rjSi1 II. | rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https: | WB-STRAIN:WBStrain00051635 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:39 | 0 | ||||||
|
mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051634 | Caenorhabditis elegans | mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. | Made_by: Julie Knott and Marcus L. Vargas|"Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC." | WBGene00002957(let-858)|WBGene00003310(mir-82) | WBGene00002957(let-858), WBGene00003310(mir-82) | WB-STRAIN:WBStrain00051634 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:46 | 0 | ||||
|
bqSi577 IV; meg-3(tm4259) meg-4(ax2026) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051584 | Caenorhabditis elegans | bqSi577 IV; meg-3(tm4259) meg-4(ax2026) X. | bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germ granule defective, ~30 sterility. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343|"Made_by: Itai Toker" | WBGene00001569(meg-3)|WBGene00016485(meg-4) | WBGene00001569(meg-3), WBGene00016485(meg-4) | WB-STRAIN:WBStrain00051584 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:38 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
