Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 110 showing 2181 ~ 2200 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00034048

http://www.wormbase.org/db/get?name=WBStrain00034048

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; gaIs288; gaIs289.
Alternate IDs: WB-STRAIN:SD1960, CGC_SD1960
Notes: gaIs288 [ges-1p::H1-wCherry + unc-119(+)]. gaIs289 [his-72::GFP + unc-119(+)]. Reference: Mann F, et al. PLoS.

Proper citation: RRID:WB-STRAIN:WBStrain00034048 Copy   

    • RRID:WB-STRAIN:WBStrain00034049

http://www.wormbase.org/db/get?name=WBStrain00034049

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004323(rde-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004323(rde-1), WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; rde-1(ne300) V; gaEx234.
Alternate IDs: WB-STRAIN:SD1963, CGC_SD1963
Notes: gaEx234 [elt-2p::elt-2::GFP + unc-119(+)]. Pick non-Unc to maintain. Long-lived. Overexpression of ELT-2. RNAi-resistant. Reference: Mann F, et al. PLoS.

Proper citation: RRID:WB-STRAIN:WBStrain00034049 Copy   

    • RRID:WB-STRAIN:WBStrain00034050

http://www.wormbase.org/db/get?name=WBStrain00034050

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004323(rde-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004323(rde-1), WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; rde-1(ne300) V; gaEx233.
Alternate IDs: WB-STRAIN:SD1965, CGC_SD1965
Notes: gaEx233 [unc-119(+)]. Pick non-Unc to maintain. Reference: Mann F, et al. PLoS.

Proper citation: RRID:WB-STRAIN:WBStrain00034050 Copy   

    • RRID:WB-STRAIN:WBStrain00034052

http://www.wormbase.org/db/get?name=WBStrain00034052

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; gaEx224.
Alternate IDs: WB-STRAIN:SD1968, CGC_SD1968
Notes: gaEx224 [W03F11.1::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational W03F11.1::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.|"gaEx224 [W03F11.1::Dendra2 + Cbr-unc-119]. Pick non-Unc to maintain. Translational W03F11.1::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015."

Proper citation: RRID:WB-STRAIN:WBStrain00034052 Copy   

    • RRID:WB-STRAIN:WBStrain00034053

http://www.wormbase.org/db/get?name=WBStrain00034053

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; gaEx225.
Alternate IDs: WB-STRAIN:SD1973, CGC_SD1973
Notes: gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.|"gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015."

Proper citation: RRID:WB-STRAIN:WBStrain00034053 Copy   

    • RRID:WB-STRAIN:WBStrain00034011

http://www.wormbase.org/db/get?name=WBStrain00034011

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: ccIs4251 I; stIs10700.
Alternate IDs: WB-STRAIN:SD1649, CGC_SD1649
Notes: ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10700 [moe-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

Proper citation: RRID:WB-STRAIN:WBStrain00034011 Copy   

    • RRID:WB-STRAIN:WBStrain00034015

http://www.wormbase.org/db/get?name=WBStrain00034015

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00001194(egl-27)
Genomic Alteration: WBGene00000898(daf-2), WBGene00001194(egl-27)
Availability: available
References:
Synonyms: egl-27(we3) II; daf-2(e1370) III; muIs84.
Alternate IDs: WB-STRAIN:SD1743, CGC_SD1743
Notes: muIs84 [sod-3p::GFP + rol-6(su1006)]. Maintain at 20C. Embryonic lethal at 15C. Dauer formation at 25C. GFP should be visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

Proper citation: RRID:WB-STRAIN:WBStrain00034015 Copy   

    • RRID:WB-STRAIN:WBStrain00034017

http://www.wormbase.org/db/get?name=WBStrain00034017

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001194(egl-27)
Genomic Alteration: WBGene00001194(egl-27)
Availability: available
References:
Synonyms: egl-27(we3) II; wgIs177.
Alternate IDs: WB-STRAIN:SD1751, CGC_SD1751
Notes: wgIs177 [egl-27p::TY1::EGFP::3xFLAG + unc-119(+)]. Maintain at 20C or higher. Embryonic lethal at 15C. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

Proper citation: RRID:WB-STRAIN:WBStrain00034017 Copy   

    • RRID:WB-STRAIN:WBStrain00034020

http://www.wormbase.org/db/get?name=WBStrain00034020

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)|WBGene00000912(daf-16)
Genomic Alteration: WBGene00000898(daf-2), WBGene00000912(daf-16)
Availability: available
References:
Synonyms: daf-16(mu86) I; daf-2(e1370) III; stIs10161.
Alternate IDs: WB-STRAIN:SD1778, CGC_SD1778
Notes: stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

Proper citation: RRID:WB-STRAIN:WBStrain00034020 Copy   

    • RRID:WB-STRAIN:WBStrain00034029

http://www.wormbase.org/db/get?name=WBStrain00034029

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006796(unc-62)
Genomic Alteration: WBGene00006796(unc-62)
Availability: available
References:
Synonyms: unc-62(e644) V; wgIs600.
Alternate IDs: WB-STRAIN:SD1879, CGC_SD1879
Notes: wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Derived from parental strains CB644 and SD1871.

Proper citation: RRID:WB-STRAIN:WBStrain00034029 Copy   

    • RRID:WB-STRAIN:WBStrain00034022

http://www.wormbase.org/db/get?name=WBStrain00034022

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; gaEx231.
Alternate IDs: WB-STRAIN:SD1821, CGC_SD1821
Notes: gaEx231 [imp-2(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of IMP-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.

Proper citation: RRID:WB-STRAIN:WBStrain00034022 Copy   

    • RRID:WB-STRAIN:WBStrain00034023

http://www.wormbase.org/db/get?name=WBStrain00034023

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; gaEx229.
Alternate IDs: WB-STRAIN:SD1822, CGC_SD1822
Notes: gaEx229 [hsf-1(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of HSF-1. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.

Proper citation: RRID:WB-STRAIN:WBStrain00034023 Copy   

    • RRID:WB-STRAIN:WBStrain00034024

http://www.wormbase.org/db/get?name=WBStrain00034024

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
References:
Synonyms: unc-119(ed3) III; gaEx232.
Alternate IDs: WB-STRAIN:SD1823
Notes: gaEx207 [sod-3p::mCherry + aakg-2(sta2) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.|"gaEx232 [aakg-2(sta2)(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of activated AAKG-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780."

Proper citation: RRID:WB-STRAIN:WBStrain00034024 Copy   

    • RRID:WB-STRAIN:WBStrain00034030

http://www.wormbase.org/db/get?name=WBStrain00034030

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006796(unc-62)
Genomic Alteration: WBGene00006796(unc-62)
Availability: available
References:
Synonyms: unc-62(s472) V; wgIs600.
Alternate IDs: WB-STRAIN:SD1880, CGC_SD1880
Notes: wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Derived from parental strains BC1282 and SD1871.

Proper citation: RRID:WB-STRAIN:WBStrain00034030 Copy   

    • RRID:WB-STRAIN:WBStrain00034119

http://www.wormbase.org/db/get?name=WBStrain00034119

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006946(prx-10)
Genomic Alteration: WBGene00006946(prx-10)
Availability: available
References:
Synonyms: prx-10(ssd68)
Alternate IDs: WB-STRAIN:SOZ259, CGC_SOZ259
Notes: Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .|"Made_by: Shaobing O. Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00034119 Copy   

    • RRID:WB-STRAIN:WBStrain00034110

http://www.wormbase.org/db/get?name=WBStrain00034110

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000256(bli-6)|WBGene00001079(dpy-20)|WBGene00006761(unc-24)|WBGene00006974(zen-4)
Genomic Alteration: WBGene00000256(bli-6), WBGene00001079(dpy-20), WBGene00006761(unc-24), WBGene00006974(zen-4)
Availability: available
References:
Synonyms: zen-4(px47) dpy-20(e1282)/bli-6(sc16) unc-24(e138)
Alternate IDs: WB-STRAIN:SM1052, CGC_SM1052
Notes: Heterozygotes are WT and segregate WT, Bli Uncs, and dead embryos and L1s (with Pun phenotype).|"Made_by: M Portereiko"

Proper citation: RRID:WB-STRAIN:WBStrain00034110 Copy   

    • RRID:WB-STRAIN:WBStrain00034199

http://www.wormbase.org/db/get?name=WBStrain00034199

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001072(dpy-10)|WBGene00002495(let-266)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00002495(let-266), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
References:
Synonyms: unc-4(e120) let-266(mn194)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:SP286, CGC_SP286
Notes: Hets are WT and segregate WT, paralysed DpyUnc and lets.

Proper citation: RRID:WB-STRAIN:WBStrain00034199 Copy   

    • RRID:WB-STRAIN:WBStrain00034113

http://www.wormbase.org/db/get?name=WBStrain00034113

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000238(bar-1)|WBGene00003510(mxl-2)
Genomic Alteration: WBGene00000238(bar-1), WBGene00003510(mxl-2)
Availability: available
References:
Synonyms: mxl-2(tm1516) III; bar-1(ga80) X.
Alternate IDs: WB-STRAIN:SM1508, CGC_SM1508
Notes: Most defects are similar to bar-1(ga80) single mutant animals [bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.] Increased severity of ray 1 displacement.

Proper citation: RRID:WB-STRAIN:WBStrain00034113 Copy   

    • RRID:WB-STRAIN:WBStrain00034114

http://www.wormbase.org/db/get?name=WBStrain00034114

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003976(pes-1)
Genomic Alteration: WBGene00003976(pes-1)
Availability: unknown
References:
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SM1535
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034114 Copy   

    • RRID:WB-STRAIN:WBStrain00034116

http://www.wormbase.org/db/get?name=WBStrain00034116

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000238(bar-1)|WBGene00001864(him-5)|WBGene00004047(plx-1)
Genomic Alteration: WBGene00000238(bar-1), WBGene00001864(him-5), WBGene00004047(plx-1)
Availability: available
References:
Synonyms: plx-1(nc37) IV; him-5(e1490) V; bar-1(ga80) X.
Alternate IDs: WB-STRAIN:SM1585, CGC_SM1585
Notes: Hermaphrodites are sluggish and exhibit protruding vulva, ruptured vulva, or internally hatched progeny. Males move slower than WT and have disorganized tail rays.

Proper citation: RRID:WB-STRAIN:WBStrain00034116 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The PRECISE-TBI toolbox are a collection tools and resources to increase rigor and reproducibility with Traumatic Brain Injury within the PRE Clinical Interagency reSearch resourcE - Traumatic Brain Injury (PRECISE-TBI). Please learn more about PRECISE-TBI at https://www.precise-tbi.org

Recent News Entries

Contact Us

Department of Neurosciences, School of Medicine

University of California, San Diego





About SciCrunch | Privacy Policy | Terms of Service

SciCrunch