Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD1960 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034048 | Caenorhabditis elegans | unc-119(ed3) III; gaIs288; gaIs289. | gaIs288 [ges-1p::H1-wCherry + unc-119(+)]. gaIs289 [his-72::GFP + unc-119(+)]. Reference: Mann F, et al. PLoS. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034048 | WormBase (WB) | WB | available | WB-STRAIN:SD1960, CGC_SD1960 | 2026-07-25 10:23:36 | 0 | |||
|
SD1963 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034049 | Caenorhabditis elegans | unc-119(ed3) III; rde-1(ne300) V; gaEx234. | gaEx234 [elt-2p::elt-2::GFP + unc-119(+)]. Pick non-Unc to maintain. Long-lived. Overexpression of ELT-2. RNAi-resistant. Reference: Mann F, et al. PLoS. | WBGene00004323(rde-1)|WBGene00006843(unc-119) | WBGene00004323(rde-1), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034049 | WormBase (WB) | WB | available | WB-STRAIN:SD1963, CGC_SD1963 | 2026-07-25 10:23:36 | 0 | |||
|
SD1965 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034050 | Caenorhabditis elegans | unc-119(ed3) III; rde-1(ne300) V; gaEx233. | gaEx233 [unc-119(+)]. Pick non-Unc to maintain. Reference: Mann F, et al. PLoS. | WBGene00004323(rde-1)|WBGene00006843(unc-119) | WBGene00004323(rde-1), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034050 | WormBase (WB) | WB | available | WB-STRAIN:SD1965, CGC_SD1965 | 2026-07-25 10:23:36 | 0 | |||
|
SD1968 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034052 | Caenorhabditis elegans | unc-119(ed3) III; gaEx224. | gaEx224 [W03F11.1::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational W03F11.1::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.|"gaEx224 [W03F11.1::Dendra2 + Cbr-unc-119]. Pick non-Unc to maintain. Translational W03F11.1::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034052 | WormBase (WB) | WB | available | WB-STRAIN:SD1968, CGC_SD1968 | 2026-07-25 10:23:36 | 0 | |||
|
SD1973 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034053 | Caenorhabditis elegans | unc-119(ed3) III; gaEx225. | gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.|"gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034053 | WormBase (WB) | WB | available | WB-STRAIN:SD1973, CGC_SD1973 | 2026-07-25 10:23:36 | 0 | |||
|
SD1649 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034011 | Caenorhabditis elegans | ccIs4251 I; stIs10700. | ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10700 [moe-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009). | WB-STRAIN:WBStrain00034011 | WormBase (WB) | WB | available | WB-STRAIN:SD1649, CGC_SD1649 | 2026-07-25 10:23:36 | 0 | |||||
|
SD1743 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034015 | Caenorhabditis elegans | egl-27(we3) II; daf-2(e1370) III; muIs84. | muIs84 [sod-3p::GFP + rol-6(su1006)]. Maintain at 20C. Embryonic lethal at 15C. Dauer formation at 25C. GFP should be visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108. | WBGene00000898(daf-2)|WBGene00001194(egl-27) | WBGene00000898(daf-2), WBGene00001194(egl-27) | WB-STRAIN:WBStrain00034015 | WormBase (WB) | WB | available | WB-STRAIN:SD1743, CGC_SD1743 | 2026-07-25 10:23:36 | 0 | |||
|
SD1751 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034017 | Caenorhabditis elegans | egl-27(we3) II; wgIs177. | wgIs177 [egl-27p::TY1::EGFP::3xFLAG + unc-119(+)]. Maintain at 20C or higher. Embryonic lethal at 15C. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108. | WBGene00001194(egl-27) | WBGene00001194(egl-27) | WB-STRAIN:WBStrain00034017 | WormBase (WB) | WB | available | WB-STRAIN:SD1751, CGC_SD1751 | 2026-07-25 10:23:36 | 0 | |||
|
SD1778 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034020 | Caenorhabditis elegans | daf-16(mu86) I; daf-2(e1370) III; stIs10161. | stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108. | WBGene00000898(daf-2)|WBGene00000912(daf-16) | WBGene00000898(daf-2), WBGene00000912(daf-16) | WB-STRAIN:WBStrain00034020 | WormBase (WB) | WB | available | WB-STRAIN:SD1778, CGC_SD1778 | 2026-07-25 10:23:36 | 0 | |||
|
SD1879 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034029 | Caenorhabditis elegans | unc-62(e644) V; wgIs600. | wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Derived from parental strains CB644 and SD1871. | WBGene00006796(unc-62) | WBGene00006796(unc-62) | WB-STRAIN:WBStrain00034029 | WormBase (WB) | WB | available | WB-STRAIN:SD1879, CGC_SD1879 | 2026-07-25 10:23:36 | 0 | |||
|
SD1821 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034022 | Caenorhabditis elegans | unc-119(ed3) III; gaEx231. | gaEx231 [imp-2(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of IMP-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034022 | WormBase (WB) | WB | available | WB-STRAIN:SD1821, CGC_SD1821 | 2026-07-25 10:23:36 | 0 | |||
|
SD1822 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034023 | Caenorhabditis elegans | unc-119(ed3) III; gaEx229. | gaEx229 [hsf-1(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of HSF-1. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034023 | WormBase (WB) | WB | available | WB-STRAIN:SD1822, CGC_SD1822 | 2026-07-25 10:23:36 | 0 | |||
|
SD1823 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034024 | Caenorhabditis elegans | unc-119(ed3) III; gaEx232. | gaEx207 [sod-3p::mCherry + aakg-2(sta2) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.|"gaEx232 [aakg-2(sta2)(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of activated AAKG-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00034024 | WormBase (WB) | WB | unknown | WB-STRAIN:SD1823 | 2026-07-25 10:23:36 | 0 | |||
|
SD1880 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034030 | Caenorhabditis elegans | unc-62(s472) V; wgIs600. | wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Derived from parental strains BC1282 and SD1871. | WBGene00006796(unc-62) | WBGene00006796(unc-62) | WB-STRAIN:WBStrain00034030 | WormBase (WB) | WB | available | WB-STRAIN:SD1880, CGC_SD1880 | 2026-07-25 10:23:36 | 0 | |||
|
SOZ259 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034119 | Caenorhabditis elegans | prx-10(ssd68) | Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .|"Made_by: Shaobing O. Zhang" | WBGene00006946(prx-10) | WBGene00006946(prx-10) | WB-STRAIN:WBStrain00034119 | WormBase (WB) | WB | available | WB-STRAIN:SOZ259, CGC_SOZ259 | 2026-07-25 10:23:37 | 0 | |||
|
SM1052 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034110 | Caenorhabditis elegans | zen-4(px47) dpy-20(e1282)/bli-6(sc16) unc-24(e138) | Heterozygotes are WT and segregate WT, Bli Uncs, and dead embryos and L1s (with Pun phenotype).|"Made_by: M Portereiko" | WBGene00000256(bli-6)|WBGene00001079(dpy-20)|WBGene00006761(unc-24)|WBGene00006974(zen-4) | WBGene00000256(bli-6), WBGene00001079(dpy-20), WBGene00006761(unc-24), WBGene00006974(zen-4) | WB-STRAIN:WBStrain00034110 | WormBase (WB) | WB | available | WB-STRAIN:SM1052, CGC_SM1052 | 2026-07-25 10:23:37 | 0 | |||
|
SP286 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034199 | Caenorhabditis elegans | unc-4(e120) let-266(mn194)/mnC1 [dpy-10(e128) unc-52(e444)] II. | Hets are WT and segregate WT, paralysed DpyUnc and lets. | WBGene00001072(dpy-10)|WBGene00002495(let-266)|WBGene00006744(unc-4)|WBGene00006787(unc-52) | WBGene00001072(dpy-10), WBGene00002495(let-266), WBGene00006744(unc-4), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00034199 | WormBase (WB) | WB | available | PMID:6500256 | WB-STRAIN:SP286, CGC_SP286 | 2026-07-25 10:23:38 | 0 | ||
|
SM1508 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034113 | Caenorhabditis elegans | mxl-2(tm1516) III; bar-1(ga80) X. | Most defects are similar to bar-1(ga80) single mutant animals [bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.] Increased severity of ray 1 displacement. | WBGene00000238(bar-1)|WBGene00003510(mxl-2) | WBGene00000238(bar-1), WBGene00003510(mxl-2) | WB-STRAIN:WBStrain00034113 | WormBase (WB) | WB | available | WB-STRAIN:SM1508, CGC_SM1508 | 2026-07-25 10:23:37 | 0 | |||
|
SM1535 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034114 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00003976(pes-1) | WBGene00003976(pes-1) | WB-STRAIN:WBStrain00034114 | WormBase (WB) | WB | unknown | WB-STRAIN:SM1535 | 2026-07-25 10:23:37 | 0 | |||
|
SM1585 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00034116 | Caenorhabditis elegans | plx-1(nc37) IV; him-5(e1490) V; bar-1(ga80) X. | Hermaphrodites are sluggish and exhibit protruding vulva, ruptured vulva, or internally hatched progeny. Males move slower than WT and have disorganized tail rays. | WBGene00000238(bar-1)|WBGene00001864(him-5)|WBGene00004047(plx-1) | WBGene00000238(bar-1), WBGene00001864(him-5), WBGene00004047(plx-1) | WB-STRAIN:WBStrain00034116 | WormBase (WB) | WB | available | WB-STRAIN:SM1585, CGC_SM1585 | 2026-07-25 10:23:37 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
