Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 101 showing 2001 ~ 2020 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00023445

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00023445

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:38301974, PMID:38669260
Synonyms: unc-119(ed3) III; jrIs2.
Alternate IDs: WB-STRAIN:JV2, CGC_JV2
Notes: jrIs2 [rpl-17p::Grx1-roGFP2 + unc-119(+)]. Stable transgene ubiquituously expressing the roGFP2 sensor under a ribosomal promoter for in vivo estimation of GSSG/2GSH ratios. Reference: Back P, et al. Free Radic Biol Med. 2012 Mar 1;52(5):850-9.|"Made_by: Back & Braeckman"

Proper citation: RRID:WB-STRAIN:WBStrain00023445 Copy   


  • RRID:WB-STRAIN:WBStrain00023446

http://www.wormbase.org/db/get?name=WBStrain00023446

Source Database: WormBase (WB)
Affected Genes: WBGene00003171(mec-7)|WBGene00004397(rol-6)
Genomic Alteration: WBGene00003171(mec-7), WBGene00004397(rol-6)
Availability: available
Source References: PMID:1639062
Synonyms: jeIs1I.
Alternate IDs: WB-STRAIN:JW29, CGC_JW29
Notes: jeIs1 [mec-7(+)::lacZ + rol-6(su1006)]. Rollers. Males will mate.|"Mutagen:Gamma rays"

Proper citation: RRID:WB-STRAIN:WBStrain00023446 Copy   


  • RRID:WB-STRAIN:WBStrain00023443

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00023443

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Source References: EMPTY
Synonyms: oxSi120 II; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:JUP1, CGC_JUP1
Notes: oxSi120 [peel-1p::tagRFP::MSP-142 3'utr+ unc-119(+)]. Him. Derived from EG5897 and CB1489; not known if is unc-119(ed3) is still present in background. Reference: Batchelder EL, et al. Proc Natl Acad Sci U S A. 2011 Jul 12;108(28):11429-34.

Proper citation: RRID:WB-STRAIN:WBStrain00023443 Copy   


  • RRID:WB-STRAIN:WBStrain00023474

http://www.wormbase.org/db/get?name=WBStrain00023474

Source Database: WormBase (WB)
Affected Genes: WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00002016(hsp-16.2)
Availability: unknown
Source References: PMID:12297370
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:KC136
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00023474 Copy   


  • RRID:WB-STRAIN:WBStrain00023475

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00023475

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004117(sin-3)
Genomic Alteration: WBGene00001864(him-5), WBGene00004117(sin-3)
Availability: available
Source References: PMID:31397537
Synonyms: sin-3(tm1276) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:KC565, CGC_KC565
Notes: Mab. Pvl. Throws males.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00023475 Copy   


  • RRID:WB-STRAIN:WBStrain00023479

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00023479

Source Database: WormBase (WB)
Affected Genes: WBGene00000068(acy-1)
Genomic Alteration: WBGene00000068(acy-1)
Availability: available
Source References: PMID:34037773
Synonyms: acy-1(ce2) III.
Alternate IDs: WB-STRAIN:KG518, CGC_KG518
Notes: About normal size and distribution on food. Hyperactive locomotion. Hypersensitive to stimuli. Most mature adults have slight vulval bump. Not obviously Egl-d or Egl-c. Dominant, gain-of-function allele. Mutation is P260S. Sequence in WT: CAGTCTGTGATG C CT. Sequence in ce2: CAGTCTGTGATG T CT.|"WBStrain mapped, WBPaper00060924 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061459 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00023479 Copy   


  • RRID:WB-STRAIN:WBStrain00023476

http://www.wormbase.org/db/get?name=WBStrain00023476

Source Database: WormBase (WB)
Affected Genes: WBGene00020506(dop-3)
Genomic Alteration: WBGene00020506(dop-3)
Availability: unknown
Source References: EMPTY
Synonyms: dop-3(tm1356) X.
Alternate IDs: WB-STRAIN:KDK1
Notes: Mutagen:UV/TMP|"T14E8.3. The original strain without backcrossing was provided by the National BioResource Project at Tokyo Women's Medical University School of Medicine (Japan)."

Proper citation: RRID:WB-STRAIN:WBStrain00023476 Copy   


  • RRID:WB-STRAIN:WBStrain00023471

http://www.wormbase.org/db/get?name=WBStrain00023471

Source Database: WormBase (WB)
Affected Genes: WBGene00003295(mir-67)|WBGene00003311(mir-83)
Genomic Alteration: WBGene00003295(mir-67), WBGene00003311(mir-83)
Availability: available
Source References: EMPTY
Synonyms: mir-67(n4899) III; mir-83(n4638) IV.
Alternate IDs: WB-STRAIN:KB12, CGC_KB12
Notes: Combination mutant made with 6x outcrossed lines KB10 mir-67(n4899) and KB11 mir-83(n4638).|"Made_by: Bennett Lab"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00023471 Copy   


  • RRID:WB-STRAIN:WBStrain00023469

http://www.wormbase.org/db/get?name=WBStrain00023469

Source Database: WormBase (WB)
Affected Genes: WBGene00003295(mir-67)
Genomic Alteration: WBGene00003295(mir-67)
Availability: available
Source References: EMPTY
Synonyms: mir-67(n4899) III.
Alternate IDs: WB-STRAIN:KB10, CGC_KB10
Notes: Made_by: Horvitz Lab|"MT15982 mir-67(n4899) was outcrossed 6x to produce this strain. Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00023469 Copy   


  • RRID:WB-STRAIN:WBStrain00023463

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00023463

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; seaEx13.
Alternate IDs: WB-STRAIN:KAE28, CGC_KAE28
Notes: seaEx13 [fmo-2p::GFP + unc-119(+)]. Pick non-Unc to maintain. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.

Proper citation: RRID:WB-STRAIN:WBStrain00023463 Copy   


  • RRID:WB-STRAIN:WBStrain00023461

http://www.wormbase.org/db/get?name=WBStrain00023461

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: seaSi40 I; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:KAE10, CGC_KAE10
Notes: Made_by: Scott Leiser|"seaSi40 [(pCFJ448) (eft-3p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] I. Higher level of FMO-2 over-expression compared to KAE9. Improved healthspan, stress resistance and longevity. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8."|"seaSi40 [(pCFJ448) eft-3p::fmo-2 GFP + Cbr-unc-119(+)] I. Higher level of FMO-2 over-expression compared to KAE9. Improved healthspan, stress resistance and longevity. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8."

Proper citation: RRID:WB-STRAIN:WBStrain00023461 Copy   


  • RRID:WB-STRAIN:WBStrain00023462

http://www.wormbase.org/db/get?name=WBStrain00023462

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: seaSi182 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:KAE12, CGC_KAE12
Notes: seaSi182 [(pCFJ150) (vha-6p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] II. Over-expression of FMO-2 in the intestine. Long-lived. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.|"seaSi182 [(pCFJ150) vha-6p::fmo-2::GFP + Cbr-unc-119(+)] II. Over-expression of FMO-2 in the intestine. Long-lived. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8."

Proper citation: RRID:WB-STRAIN:WBStrain00023462 Copy   


  • RRID:WB-STRAIN:WBStrain00023500

http://www.wormbase.org/db/get?name=WBStrain00023500

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:30254025
Synonyms: unc-116(ce815[LoxP1/unc-116/sup-1/LoxP2]);ceIs276[Punc17b::CRE]; ceIs269[Punc-129::TOMM-20-Venus; Punc-129::mCherry]
Alternate IDs: WB-STRAIN:KG4768
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00023500 Copy   


  • RRID:WB-STRAIN:WBStrain00023468

http://www.wormbase.org/db/get?name=WBStrain00023468

Source Database: WormBase (WB)
Affected Genes: WBGene00002187(kgb-1)|WBGene00002188(kgb-2)
Genomic Alteration: WBGene00002187(kgb-1), WBGene00002188(kgb-2)
Availability: available
Source References: EMPTY
Synonyms: kgb-1(um3) kgb-2(km16) IV.
Alternate IDs: WB-STRAIN:KB7, CGC_KB7
Notes: Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00023468 Copy   


  • RRID:WB-STRAIN:WBStrain00023465

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00023465

Source Database: WormBase (WB)
Affected Genes: WBGene00002187(kgb-1)
Genomic Alteration: WBGene00002187(kgb-1)
Availability: available
Source References: PMID:33674585, PMID:37310929, PMID:38573858
Synonyms: kgb-1(um3) IV.
Alternate IDs: WB-STRAIN:KB3, CGC_KB3
Notes: Mutagen:UV/Psoralen|"Temperature sensitive sterile at 26C, with EMO oocytes. Grows at 15C or 20C."

Proper citation: RRID:WB-STRAIN:WBStrain00023465 Copy   


  • RRID:WB-STRAIN:WBStrain00023466

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00023466

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001598(glh-1)|WBGene00001601(glh-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001598(glh-1), WBGene00001601(glh-4)
Availability: available
Source References: EMPTY
Synonyms: glh-4(gk225) glh-1(ok439) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:KB4, CGC_KB4
Notes: Made_by: Chris Yee|"Mutagen:UV/TMP"|"Pick GFP+ to maintain balanced stock. Heterozygotes are superficially wild-type GFP+ and segregate wild-type GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP glh-4 glh-1 homozygotes (sterile; incompletely penetrant). NOTE (K. Bennett, 2012): KB4 strain is only 63% sterile at 20C and 92% sterile at 26C (Spike et al., Genetics 2008 178:1973). glh-1(ok439) is not a null allele."

Proper citation: RRID:WB-STRAIN:WBStrain00023466 Copy   


  • RRID:WB-STRAIN:WBStrain00023416

http://www.wormbase.org/db/get?name=WBStrain00023416

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:JU3127
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.

Proper citation: RRID:WB-STRAIN:WBStrain00023416 Copy   


  • RRID:WB-STRAIN:WBStrain00023414

http://www.wormbase.org/db/get?name=WBStrain00023414

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:JU2908
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.

Proper citation: RRID:WB-STRAIN:WBStrain00023414 Copy   


  • RRID:WB-STRAIN:WBStrain00023419

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00023419

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369, PMID:38865452
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:JU3132
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.

Proper citation: RRID:WB-STRAIN:WBStrain00023419 Copy   


  • RRID:WB-STRAIN:WBStrain00023497

http://www.wormbase.org/db/get?name=WBStrain00023497

Source Database: WormBase (WB)
Availability: available
Source References: PMID:30254025
Synonyms: ceIs269 I.
Alternate IDs: WB-STRAIN:KG4687, CGC_KG4687
Notes: ceIs269 [unc-129p::tomm-20::Venus + unc-129p::mCherry + ttx-3p::RFP]; Integration in Chromosome I (near genetic position -3.20 or 1.14). The ttx-3 marker is quite faint in this strain especially in larvae. The tomm-20::Venus construct was injected at 0.5 ng/ ul in the strain used to make this integrant, so virtually all of the visible tomm-20::Venus signal s associated with mitochondria with essentially no background. The unc-129p::mCherry marker is expressed at a very low level that are detectable only with a sensitive camera (and often not by eye at 1000X). In strains lacking mitochondria in the dorsal cord, use the camera to focus on the mCherry in the dorsal cord, then acquire in the YFP channel.|"Made_by: Logan Morrison"|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00023497 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X