Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pUASTattB_NSlmb-vhhGFP4 Resource Report Resource Website |
RRID:Addgene_35577 | NSlmb-vhhGFP4 | Drosophila melanogaster | Ampicillin | PMID:22157958 | Backbone Size:8500; Vector Backbone:pUASattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:02 | 0 | ||
|
pUAST_NSlmb-vhhGFP4 Resource Report Resource Website |
RRID:Addgene_35575 | NSlmb-vhhGFP4 | Drosophila melanogaster | Ampicillin | PMID:22157958 | Backbone Size:8800; Vector Backbone:pUAS; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:06 | 0 | ||
|
pUASTattB_NSnoFbox-vhhGFP4 Resource Report Resource Website |
RRID:Addgene_35578 | NSnoFbox-vhhGFP4 | Drosophila melanogaster | Ampicillin | PMID:22157958 | Backbone Size:8500; Vector Backbone:pUASattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | F box domain of slmb deleted. | 2026-08-15 01:14:02 | 0 | |
|
pENTR-E2F1-PIP3A Resource Report Resource Website |
RRID:Addgene_37142 | E2F1-P!P3A | Drosophila melanogaster | Kanamycin | PMID:19081076 | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | I153, Y156, Y157 to Alanine | 2026-08-15 01:14:13 | 0 | |
|
pCaShs-hopscotch Resource Report Resource Website |
RRID:Addgene_37299 | hopscotch | Drosophila melanogaster | Ampicillin | PMID:7796812 | Perrimon Lab plasmid #99 | Backbone Size:8900; Vector Backbone:pCaSpeR-hs; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | |
|
ovoD1 D1B2H (7.2 kb) Resource Report Resource Website |
RRID:Addgene_37282 | ovoD1 genomic DNA fragment | Drosophila melanogaster | Ampicillin | PMID:8306893 | Perrimon Lab plasmid #25 Please see associated publication for cloning details | Backbone Size:7815; Vector Backbone:pCaSpeR 2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | |
|
orthodenticle Resource Report Resource Website |
RRID:Addgene_37285 | orthodenticle | Drosophila melanogaster | Ampicillin | PMID:1979296 | Perrimon Lab plasmid #46 | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBlueScript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | |
|
10XSTAT92E–luciferase Resource Report Resource Website 1+ mentions |
RRID:Addgene_37393 | SOCS36E enhancer fragment | Drosophila melanogaster | Ampicillin | PMID:16055650 | Perrimon Lab plasmid #446 A 441-bp genomic fragment in the enhancer of SOCS36E containing two potential STAT92E-binding sites was amplified by PCR, using five different sets of oligos: (1) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (2) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), CTGCAGATACAAAACTGTCTTAGGTGTTTA (PstI); (3) GAATTCGAACCACTCAGAGTGCCTGCGTGT (EcoRI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (4) AGATCTGAACCACTCAGAGTGCCTGCGTGT (BglII), AGATCTATACAAAACTGTCTTAGGTGTTTA (BglII); (5) GCGGCCGCGAACCACTCAGAGTGCCTGCGTGT (NotI), GCGGCCGCATACAAAACTGTCTTAGGTGTTTA (NotI). Each amplified genomic fragment containing different restriction enzyme sites was sequentially subcloned into pUAST. The genomic fragment amplified using the first set of oligos was subcloned into the PstI/EcoRI sites of pUAST to generate 2XSTAT92E. The genomic fragment amplified using the second set of oligos was subcloned into the PstI site of 2XSTAT92E to generate 4XSTAT92E. The genomic fragment amplified using the third set of oligos was subcloned into the EcoRI site of 4XSTAT92E to generate 6XSTAT92E. The genomic fragment amplified using the fourth set of oligos was subcloned into the BglII site of 6XSTAT92E to generate 8XSTAT92E. Next, the hsp70 minimal promoter element was amplified from pUAST by PCR using oligos GCGGCCGCAGCGGAGACTCTAGCGAGCG (NotI) and CTCGAGAATTCCCTATTCAGAGTTCT (XhoI). This hsp70 minimal promoter was subcloned into the NotI/XhoI sites of 8XSTAT92E to generate 8XSTAT92E–hsp70. Again, the genomic fragment amplified using the fifth set of oligos was subcloned into the NotI site of 8XSTAT92E–hsp70 vector to generate 10XSTAT92E–hsp70. Finally, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3–luciferase vector (Promega) was subcloned into the XhoI/XbaI sites of 10XSTAT92E–hsp70 to generate 10XSTAT92E–luciferase. | Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression, Luciferase, JAK/STAT reporter construct; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 2 | |
|
ovoD1 D1B2NR (18 kb) Resource Report Resource Website |
RRID:Addgene_37280 | ovoD1 genomic DNA fragment | Drosophila melanogaster | Ampicillin | PMID:8306893 | Perrimon Lab plasmid #23 Please see associated publication for cloning details | Backbone Size:7815; Vector Backbone:pCaSpeR 2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | |
|
pUAS-hopscotch Resource Report Resource Website |
RRID:Addgene_37301 | hopscotch | Drosophila melanogaster | Ampicillin | PMID:7796812 | Perrimon Lab plasmid #100 | Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | |
|
pCaShs-Tum Resource Report Resource Website |
RRID:Addgene_37303 | hopTum-1 | Drosophila melanogaster | Ampicillin | PMID:7796812 | Perrimon Lab plasmid #101 The pCaShs-Tum construct was generated by the replacement of a 220 bp SacII-BstEII fragment from pCaShs-hop (Addgene plasmid# 37299) with the same fragment of PCR-generated DNA from hopTum-1 hemizygous flies. This mutation is a G to A transversion at nucleotide 1641 resulting in the substitution of a Glu for a Gly at amino acid 341. | Backbone Marker:Addgene plasmid# 37299; Vector Backbone:pCaShs-hopscotch; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Tul-l mutation is a G to A transversion at nucleotide 1641 resulting in the substitution of a Glu for a Gly at amino acid 341 | 2026-08-15 01:14:14 | 0 |
|
pUAS-Tum Resource Report Resource Website |
RRID:Addgene_37304 | hopTum-1 | Drosophila melanogaster | Ampicillin | PMID:7796812 | Perrimon Lab plasmid #102 The pUAS-Tum was made by the insertion of the NotI-XbaI fragment from pCaShs-Tum (Addgene plasmid# 37303) into pUAST. | Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Tul-l mutation is a G to A transversion at nucleotide 1641 resulting in the substitution of a Glu for a Gly at amino acid 341 | 2026-08-15 01:14:14 | 0 |
|
pCaSpeR-4 porcupine (genomic DNA) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37376 | porcupine | Drosophila melanogaster | Ampicillin | PMID:8985181 | Perrimon Lab plasmid #123 The EcoRI-XbaI genomic DNA covering the porc locus was cloned in pCaspeR4 to generate a genomic porc rescue construct. | Backbone Size:7855; Vector Backbone:pCaSpeR-4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 1 | |
|
porcupine Resource Report Resource Website |
RRID:Addgene_37377 | porcupine | Drosophila melanogaster | Ampicillin | PMID:8985181 | Perrimon Lab plasmid #124 | Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | |
|
tout velou (ttv) Resource Report Resource Website |
RRID:Addgene_37401 | tout-velu | Drosophila melanogaster | Ampicillin | PMID:9665133 | Perrimon Lab plasmid #179 | Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | |
|
pCFJ1209 Resource Report Resource Website |
RRID:Addgene_44491 | Minimal Mos1 [Peft-3 tdTomato(NLS) tbb-2 UTR, NeoR] | Drosophila melanogaster | Ampicillin | PMID:24820376 | Backbone Marker:Invitrogen; Backbone Size:2445; Vector Backbone:pDESTR4-R3; Vector Types:Gateway expression clone; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:15 | 0 | ||
|
pCFJ1200 Resource Report Resource Website |
RRID:Addgene_44485 | Minimal Mos1, PuroR, peel-1, MCS | Drosophila melanogaster | Ampicillin | PMID:24820376 | Backbone Marker:Invitrogen; Backbone Size:2305; Vector Backbone:pDESTR4-R3; Vector Types:Multiple cloning site vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:15 | 0 | ||
|
pCFJ1202 Resource Report Resource Website 1+ mentions |
RRID:Addgene_44484 | Minimal Mos1, NeoR, peel-1, MCS | Drosophila melanogaster | Ampicillin | PMID:24820376 | Backbone Marker:Invitrogen; Backbone Size:2305; Vector Backbone:pDESTR4-R3; Vector Types:Multiple cloning site vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:16 | 1 | ||
|
pCFJ1272 Resource Report Resource Website |
RRID:Addgene_44486 | Minimal Mos1, MCS | Drosophila melanogaster | Ampicillin | PMID:24820376 | Backbone Marker:Invitrogen; Backbone Size:2305; Vector Backbone:pDESTR4-R3; Vector Types:Multiple cloning site vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:15 | 0 | ||
|
pCFJ914 Resource Report Resource Website 1+ mentions |
RRID:Addgene_44489 | Minimal Mos1 [Peft-3 GFP H2B tbb-2 UTR, NeoR] | Drosophila melanogaster | Ampicillin | PMID:24820376 | Backbone Marker:Invitrogen; Backbone Size:2445; Vector Backbone:pDESTR4-R3; Vector Types:Gateway expression clone; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:15 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.