Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 199 results
Snippet view Table view Download 199 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_21875

http://www.addgene.org/21875

Genetic Insert: CSH100 bacterial Strain
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:19798082
Comments: F’ lac proA+proB+(lacIq lacPL8)/ara- ∆(gpt-lac)5 This strain will be shipped as bacteria in an LB stab. Upon receipt, requesting scientists should restreak the strain on an M9 minimal plate. After restreaking on M9 to confirm the presence of the F', scientists can grow the strain in liquid LB. M9 minimal medium agar plates: To prepare 500 ml, autoclave 439 ml H2O with 7.5 g Bacto-agar and a stir bar. When agar has cooled to approximately 65°C, add 50 ml 10X M9 salts, 1 ml 1 M MgSO4, 10 ml 20% (w/v) glucose and 0.5 ml 100mM CaCl2 and then pour plates. Plates can be stored indefinitely at 4°C in sealed plastic bags. (Alternatively, M9 plates can be purchased from Teknonva: https://www.teknova.com/content/teknova/us/en/products/product-page.html/m1260.html).

Proper citation: RRID:Addgene_21875 Copy   


  • RRID:Addgene_176581

http://www.addgene.org/176581

Genetic Insert: This is a strain.
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc

Proper citation: RRID:Addgene_176581 Copy   


  • RRID:Addgene_134836

http://www.addgene.org/134836

Genetic Insert: lysogen of a temperature-inducible bacteriophage lambda
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:28522818
Comments: Genotype is [λ+ Lac- galK2 IN(rrnD-rrnE)1 rph-1], a derivative of strain W3102 Phenotypic assay: Grow at 30°C, but restricted at 42°C due to the induction of phage particles and cell lysis.

Proper citation: RRID:Addgene_134836 Copy   


  • RRID:Addgene_115924

http://www.addgene.org/115924

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29765036
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-sulA-GFP Integration at HK022 attB: pOSIP-KO-RBS2-dCas9 SulA-GFP acts as an SOS response reporter.

Proper citation: RRID:Addgene_115924 Copy   


  • RRID:Addgene_115926

http://www.addgene.org/115926

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29765036
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-KO-RBS2-dCas9 mCherry quantifies dCas9 repression

Proper citation: RRID:Addgene_115926 Copy   


  • RRID:Addgene_119737

http://www.addgene.org/119737

Vector Backbone Description: Vector Backbone:See supplemental files for plasmid details; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:30738800
Comments: Strain can be grown on LB without antibiotics. Resistant to: ampicillin, chloramphenicol, florfenicol, gentamicin, kanamycin, nalidixic acid, streptomycin, spectinomycin, sulphonamides, tobramycin, tetracycline, trimethoprim Please note that plasmids are stable in the absence of antibiotic selection. 39R861+ is resistant to nalidixic acid due to a chromosomal mutation. The remaining resistance determinants are plasmid-borne. 39R861+ contains six plasmids, outlined in the supplemental files.

Proper citation: RRID:Addgene_119737 Copy   


  • RRID:Addgene_11794

http://www.addgene.org/11794

Genetic Insert: JS200
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:12909725
Comments: For use with pEP PolI (addgene #11722) and pWT PolI (addgene #11721). This strain contains a temp sens mutation in PolI.

Proper citation: RRID:Addgene_11794 Copy   


  • RRID:Addgene_118727

    This resource has 1+ mentions.

http://www.addgene.org/118727

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:30403660
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at HK022 attB: pOSIP-KH-RBS2-dCas9

Proper citation: RRID:Addgene_118727 Copy   


  • RRID:Addgene_141407

http://www.addgene.org/141407

Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:31980824
Comments: λ- F- glnX44 e14- (McrA-) rfbD1 endA1 thi-1 Δ(yjiT-opgB)114::IS10 (EcoKI R- M- McrBC- Mrr-) + rpoS393(am) creC510 lrhA::IS3 ydeN::IS10 ΔlacI Verification of lacI deletion: PCR reaction on genomic DNA using AK362 and AK365 primers produces a 1936 bp fragment AK 362 5’-CAATACCAATCGCACGCGG AK 365 5’-CGAGACGTCACGGAAAATGCC Phenotype: Constitutive β-galactosidase synthesis This strain was derived from the precursor strain, E. coli ER1821, which is described in Jobling et al. (2016) Complete Genome Sequence of Escherichia coli ER1821R, a Laboratory K-12 Derivative Engineered To Be Deficient in All Methylcytosine and Methyladenine Restriction Systems. Genome Announc 4(4):e00763-16. https://www.ncbi.nlm.nih.gov/pubmed/27516504

Proper citation: RRID:Addgene_141407 Copy   


http://www.addgene.org/188474

Genetic Insert: P-R-lox-TT-lox-bla
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188474 Copy   


http://www.addgene.org/188475

Genetic Insert: P-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188475 Copy   


http://www.addgene.org/188476

Genetic Insert: P*-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188476 Copy   


  • RRID:Addgene_197112

http://www.addgene.org/197112

Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Comments: E. coli MEV15 is engineered to host sesquiterpenoid biosynthetic pathways. Sesquiterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Sesquiterpenoid production can be induced by IPTG, vanillic aci, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and E. coli ispA inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing.

Proper citation: RRID:Addgene_197112 Copy   


  • RRID:Addgene_200839

http://www.addgene.org/200839

Species: Escherichia coli str. K-12 substr. MG1655
Genetic Insert: Genotype: MG1655 rph+, ilvG+, ΔlacZ
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:20952573
Comments: Corresponding wild-type strain (rapZ+, glmZ+, glmY+) for strain Z956 (Addgene Bacterial strain #200838).

Proper citation: RRID:Addgene_200839 Copy   


  • RRID:Addgene_197933

http://www.addgene.org/197933

Genetic Insert: RNA polymerase gene (T7 phage)/chromosome
Vector Backbone Description: Vector Backbone:BL21(DE3); Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:25982672
Comments: Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons and disruption of the prfA gene

Proper citation: RRID:Addgene_197933 Copy   


http://www.addgene.org/192874

Species: E.coli
Genetic Insert: The strain has a 535 nt deletion between nt 15 and nt 551 in the EntD gene.
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:16709676
Comments: EntD, a 4'-phosphopantetheinyl transferase, is required for native enterobactin synthesis. This strain allows for expression of nonribosomal peptide synthetase (NRPS) carrier proteins that do not harbor a phosphopantetheinyl group.

Proper citation: RRID:Addgene_192874 Copy   


  • RRID:Addgene_52704

http://www.addgene.org/52704

Genetic Insert: KI (37)-Oplac2 strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of Oplac2 with those of KIlac, producing and KI(37)-Oplac2.

Proper citation: RRID:Addgene_52704 Copy   


  • RRID:Addgene_52705

http://www.addgene.org/52705

Genetic Insert: degtag strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: To generate the degtag strain, we introduced the ssrA tag to the C-terminus of LacZ, thus targeting the protein for degradation by the ClpXP and ClpAP proteases.

Proper citation: RRID:Addgene_52705 Copy   


  • RRID:Addgene_52703

http://www.addgene.org/52703

Genetic Insert: KI (37)-Oplac1 strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of OpLac1 with those of KIlac.

Proper citation: RRID:Addgene_52703 Copy   


  • RRID:Addgene_52700

http://www.addgene.org/52700

Genetic Insert: OpLac2-Δ6 strain
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: Oplac2Δ6 was erroneously synthesized missing the first 6 nucleotides of Oplac2. These deletions correspond to the first 2 N-terminal amino acid residues (Methionine and Threonine), and instead begin at the Methionine at position 3.

Proper citation: RRID:Addgene_52700 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X