Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 790 results
Snippet view Table view Download 790 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_21604

http://www.addgene.org/21604

Genetic Insert: UAS-hsp70 luciferase
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3415; Vector Backbone:pBluescript SK(-); Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:19481053

Proper citation: RRID:Addgene_21604 Copy   


  • RRID:Addgene_180057

http://www.addgene.org/180057

Species: SARS-CoV-2
Genetic Insert: SARS-CoV-2 NSP3 K977Q
Vector Backbone Description: Vector Backbone:pDON207; Vector Types:Mammalian Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34709727

Proper citation: RRID:Addgene_180057 Copy   


  • RRID:Addgene_180515

    This resource has 1+ mentions.

http://www.addgene.org/180515

Genetic Insert: Tobacco rattle virus RNA1
Vector Backbone Description: Vector Backbone:pLX-Z4; Vector Types:Plant Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35332696

Proper citation: RRID:Addgene_180515 Copy   


http://www.addgene.org/178074

Species: Homo sapiens
Genetic Insert: MZT2A
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178074 Copy   


  • RRID:Addgene_178071

http://www.addgene.org/178071

Species: Homo sapiens
Genetic Insert: GCP5
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178071 Copy   


  • RRID:Addgene_178072

    This resource has 1+ mentions.

http://www.addgene.org/178072

Species: Homo sapiens
Genetic Insert: GCP6
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178072 Copy   


http://www.addgene.org/178077

Species: Homo sapiens
Genetic Insert: gamma-tubulin with an N229A point mutation
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Comments: Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG

Proper citation: RRID:Addgene_178077 Copy   


  • RRID:Addgene_178075

http://www.addgene.org/178075

Species: Homo sapiens
Genetic Insert: MZT1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178075 Copy   


  • RRID:Addgene_178076

http://www.addgene.org/178076

Species: Homo sapiens
Genetic Insert: beta-actin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178076 Copy   


http://www.addgene.org/178067

Species: Homo sapiens
Genetic Insert: gamma-tubulin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178067 Copy   


  • RRID:Addgene_178940

http://www.addgene.org/178940

Species: Synthetic
Genetic Insert: mScarlet counter-selection cassette
Vector Backbone Description: Backbone Size:2607; Vector Backbone:BASIC_SEVA_67.10; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:36381610
Comments: Cloning method: BASIC DNA assembly . Please visit https://www.biorxiv.org/content/10.1101/2022.01.06.446575v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_178940 Copy   


  • RRID:Addgene_14467

    This resource has 1+ mentions.

http://www.addgene.org/14467

Species: E.coli
Genetic Insert: lacZ
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pbbr; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16207908
Comments: Use gentamicin at 10 ug/mL.

Proper citation: RRID:Addgene_14467 Copy   


  • RRID:Addgene_14463

http://www.addgene.org/14463

Species: Aequorea
Genetic Insert: unstable gfp-mut3.1 LAA
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pbbr; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16207908
Comments: Use gentamicin at 10 ug/mL.

Proper citation: RRID:Addgene_14463 Copy   


  • RRID:Addgene_14471

    This resource has 1+ mentions.

http://www.addgene.org/14471

Species: Discoma
Genetic Insert: mRFP1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pbbr; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16207908
Comments: Use gentamicin at 10 ug/mL.

Proper citation: RRID:Addgene_14471 Copy   


http://www.addgene.org/159718

Species: Homo sapiens
Genetic Insert: MAP7 (Microtubule Associated Protein 7)
Vector Backbone Description: Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35050657

Proper citation: RRID:Addgene_159718 Copy   


http://www.addgene.org/159720

Species: Homo sapiens
Genetic Insert: KIF5B (only amino acids 1-560), K560
Vector Backbone Description: Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35050657

Proper citation: RRID:Addgene_159720 Copy   


http://www.addgene.org/159721

Species: Homo sapiens
Genetic Insert: KIF5B (only amino acids 1-490), K490
Vector Backbone Description: Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35050657

Proper citation: RRID:Addgene_159721 Copy   


http://www.addgene.org/159728

Species: Homo sapiens
Genetic Insert: MAP7 (only amino acids 1-316)(includes MTBD and P123 domains)
Vector Backbone Description: Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35050657

Proper citation: RRID:Addgene_159728 Copy   


http://www.addgene.org/159727

Species: Homo sapiens
Genetic Insert: KIF5B (full length, 1-963 amino acids), K963
Vector Backbone Description: Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35050657

Proper citation: RRID:Addgene_159727 Copy   


  • RRID:Addgene_160206

http://www.addgene.org/160206

Vector Backbone Description: Vector Backbone:pST50Trc; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:32955754

Proper citation: RRID:Addgene_160206 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X