Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
p221z-erVenusYFP Resource Report Resource Website |
RRID:Addgene_71265 | VenusYFP | Other | Bleocin (Zeocin) | PMID:26644504 | Backbone Marker:Invitrogen; Vector Backbone:pDONR/Zeo; Vector Types:Gateway Cloning; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:09:41 | 0 | ||
|
pJK138 Resource Report Resource Website |
RRID:Addgene_73314 | Pas2p (peroxisomal membrane targeting region) | Komagataella pastoris | Bleocin (Zeocin) | Backbone Size:3329; Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | encodes residues 1-42 | 2026-08-29 01:10:02 | 0 | ||
|
pJK142 Resource Report Resource Website |
RRID:Addgene_73317 | delta-12 fatty acid acetylenase | Crepis alpina | Bleocin (Zeocin) | Backbone Size:3329; Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | synthetic gene. Encodes a glycine-204 to serine mutation in the Pas2 fusion domain | 2026-08-29 01:10:02 | 0 | ||
|
Strain: C321.ΔA Resource Report Resource Website 10+ mentions |
RRID:Addgene_68306 | None | Bleocin (Zeocin) | PMID:26350500 | Derived from Lajoie, et. al., Genomically recoded organisms expand biological functions, Science, 2013, with the following genomic modifications: ΔmutS:zeo, ΔtolC, Δbla:tolC, SerB-/ΔSerB | Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:09:15 | 13 | ||
|
pCri-15b Resource Report Resource Website |
RRID:Addgene_61336 | Green fluorescent protein | Bleocin (Zeocin) | PMID:25386923 | Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:08:13 | 0 | |||
|
pIZ-Flag6His-BmAgo3 Resource Report Resource Website |
RRID:Addgene_50559 | BmAgo3 | Bombyx mori | Bleocin (Zeocin) | PMID:19460866 | Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:06:33 | 0 | ||
|
pBudORF2-CH Resource Report Resource Website 1+ mentions |
RRID:Addgene_51289 | L1 ORF2 | Homo sapiens | Bleocin (Zeocin) | PMID:21572950 | This plasmid was created using the codon optimized L1RP as a source for the ORF2 coding sequence. | Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:06:38 | 2 | |
|
pCoofy42 Resource Report Resource Website |
RRID:Addgene_55190 | Bleocin (Zeocin) | PMID:23410102 | C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected. | Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:07:17 | 0 | |||
|
pBoPyV2a-S22 Resource Report Resource Website |
RRID:Addgene_62356 | Full genome of BoPyV2a isolate S22 | Viruses (Polyomaviridae) | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with SacII | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:08:26 | 0 | |
|
pBoPyV3-S22 Resource Report Resource Website |
RRID:Addgene_62368 | Full genome of BoPyV3 isolate S22 | Viruses (Polyomaviridae) | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with EcoRI | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:08:26 | 0 | |
|
pBoPyV3-S23 Resource Report Resource Website |
RRID:Addgene_62369 | Full genome of BoPyV3 isolate S23 | Viruses (Polyomaviridae) | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with EcoRI | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:08:24 | 0 | |
|
p8RwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_48733 | dsRed-Express | Discosoma sp | Bleocin (Zeocin) | PMID:17603495 | This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:06:19 | 2 | |
|
pRwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_48734 | dsRed-Express | Discosoma sp | Bleocin (Zeocin) | PMID:19073722 | Note that this plasmid is substantially smaller than the ~8kb native papillomavirus genome. There is a second version of this plasmid with a 2kb stuffer region that is available here: http://www.addgene.org/48733 . Further information can be found here: http://home.ccr.cancer.gov/Lco/target.htm | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:06:19 | 1 | |
|
M-tdTom-SP Resource Report Resource Website 1+ mentions |
RRID:Addgene_48677 | TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 | Synthetic | Bleocin (Zeocin) | PMID:24076762 | Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:06:18 | 2 | ||
|
C321.ΔA.exp Resource Report Resource Website 10+ mentions |
RRID:Addgene_49018 | Recoded E. coli with all UAG codons and RF1 removed (UAG termination abolished); decreased mutation rate; 37C growth tolerated | E. coli | Bleocin (Zeocin) | PMID:24136966 | E. coli MG1655 Delta(ybhB-bioAB)::zeoR Delta prfA; all 321 UAG codons changed to UAA This strain is mutS+, which causes a normal spontaneous mutation frequency of ~1E-10. This strain is auxotrophic for d-biotin. The genome sequence of a similar strain (C321.deltaA) was deposited at NCBI (accession # CP006698.1). | Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin) | See genbank file | 2026-08-29 01:06:21 | 31 |
|
pPICZA_CeTRIC-B1_Del Resource Report Resource Website |
RRID:Addgene_87344 | TRIC-B1 | Caenorhabditis elegans | Bleocin (Zeocin) | PMID:27698420 | Vector pPICZ A and insert sequence were modified as follows: 1. Restriction sites including Pml I; Sfi I; BsmB I; Asp718 I; Kpn I were destroyed during cloning full-length CeTRIC-B1 to the vector. 2. In the C-terminal truncation, the sequence between XhoI and polyhistidine had been deleted. That is to say, restriction sites including Xho I, Sac II, Not I, Apa I, and myc-epitope, were destroyed during truncation. 3. A kozak suqence "ACC" was inserted between the restriction site "EcoR I" and initial codon, we added these 3 bp into insert sequence size. In summary, the size of pPICZ A backbone is changed from 3329 bp to be 3221 bp. | Backbone Marker:Invitrogen; Backbone Size:3221; Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | Δ248-297 | 2026-08-29 01:12:20 | 0 |
|
p16L1-GFP Resource Report Resource Website |
RRID:Addgene_89910 | HPV16L1+ GFP | Homo sapiens | Bleocin (Zeocin) | PMID:15709003 | Backbone Marker:Invitrogen; Vector Backbone:many different ones; Vector Types:Unspecified; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:12:39 | 0 | ||
|
PP298 Resource Report Resource Website |
RRID:Addgene_78938 | GFP | Bleocin (Zeocin) | PMID:27470089 | Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:11:05 | 0 | |||
|
PP255 Resource Report Resource Website |
RRID:Addgene_78934 | GFP | Bleocin (Zeocin) | PMID:27470089 | Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:11:05 | 0 | |||
|
PP296 Resource Report Resource Website |
RRID:Addgene_78936 | GFP | Bleocin (Zeocin) | PMID:27470089 | Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:11:04 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
