Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,495 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-mKate2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51092 oChIEF(E163A/T199C) Synthetic Ampicillin The addition of the E163A and T199C mutations in oChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity. Backbone Marker:custom; Backbone Size:5100; Vector Backbone:pAAV-CaMKIIa-WPRE-HGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin E163A/T199C 2026-08-15 01:16:14 1
pSIR-DsRed-Express2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51135 Ampicillin PMID:25051498 Backbone Marker:Clontech; Backbone Size:8089; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:16:11 2
AAV-EF1a-DIO-ChIEF(E162A/T198C)-P2A-dTomato-WPRE-BGHpA
 
Resource Report
Resource Website 		RRID:Addgene_51095 ChIEF(E162A/T198C) Synthetic Ampicillin The addition of the E162A and T198C mutations in ChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity. Backbone Marker:custom; Backbone Size:1047; Vector Backbone:pAAV-EF1a-DIO-WPRE-BGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin E162A/T198C 2026-08-15 01:16:14 0
hUbc13
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51131 ubc13 Homo sapiens Ampicillin PMID:22367539 Backbone Marker:Novagen; Backbone Size:5800; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:14 4
Cin85-3SH3-pCMV6-AN-GFP
 
Resource Report
Resource Website 		RRID:Addgene_51137 Cin85 Homo sapiens Ampicillin Backbone Marker:Origene; Backbone Size:6600; Vector Backbone:pCMV6-AN-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contains 3 SH3 domains 2026-08-15 01:16:11 0
pICSL11024 (pICH47732::NOSp-NPTII-OCST)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_51144 NOSp-NPTII-OCST Synthetic Ampicillin Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH47732; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:16:14 22
pSLQ1661-sgMUC4-E3(F+E)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51025 optimized sgRNA Homo sapiens Ampicillin PMID:24360272 gRNA target sequence GTGGCGTGACCTGTGGATGCTG Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:13 8
pSLQ1651-sgTelomere(F+E)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_51024 Optimized sgRNA Homo sapiens Ampicillin PMID:24360272 gRNA target sequence GTTAGGGTTAGGGTTAGGGTTA Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 18
pICSL11017 (pICH47732::NOSp-BAR-NOST)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51145 NOSp-BAR-NOST Synthetic Ampicillin Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH47732; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:16:11 1
AAV-oChD-citrine
 
Resource Report
Resource Website 		RRID:Addgene_50976 oChD-citrine Ampicillin PMID:19254539 WPRE is inserted after the citrine before SV40 polyA. Backbone Size:4599; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin ChD gene is mammalian codon optimized 2026-08-15 01:16:10 0
AAV-oChEF-citrine
 
Resource Report
Resource Website 		RRID:Addgene_50975 ChEF-citrine Synthetic Ampicillin PMID:19254539 WPRE is inserted after the citrine before SV40 polyA. Backbone Size:4599; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin ChEF gene is mammalian codon optimized 2026-08-15 01:16:10 0
AAV-oChIEF-tdTomato
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50977 ChIEF-tdTomato Synthetic Ampicillin PMID:19254539 Backbone Size:4599; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin ChIEF gene is mammalian codon optimized 2026-08-15 01:16:13 8
pET21a-AcrR
 
Resource Report
Resource Website 		RRID:Addgene_51148 AcrR Escherichia coli Ampicillin PMID:24316737 UCSF Case No. SF11-016-2; U.S. Patent Application 13/489,205. GeneArt inserted the synthesized fragment into a pET21a vector. Vector Backbone:pET21a; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:14 0
pLA CMV N-HA RALB WT
 
Resource Report
Resource Website 		RRID:Addgene_50989 RALB Homo sapiens Ampicillin PMID:24056301 Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:16:13 0
pLA CMV N-Flag RALB V23 R47
 
Resource Report
Resource Website 		RRID:Addgene_50983 RALB Homo sapiens Ampicillin PMID:24056301 Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin G23V, K47R 2026-08-15 01:16:10 0
pLA CMV N-Flag RALB V23 R160
 
Resource Report
Resource Website 		RRID:Addgene_50982 RALB Homo sapiens Ampicillin PMID:24056301 Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin G23V K160R 2026-08-15 01:16:10 0
Human Lentiviral sgRNA Library - Ribosomal Proteins
 
Resource Report
Resource Website 		RRID:Addgene_51045 sgRNA library (enriched for ribosomal targets) Homo sapiens Ampicillin PMID:24336569 The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
Human Lentiviral sgRNA Library - Kinases
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51044 sgRNA library (enriched for kinase targets) Homo sapiens Ampicillin PMID:24336569 The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:13 4
Human Lentiviral sgRNA Library - Nuclear
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51047 sgRNA library (enriched for nuclear targets) Homo sapiens Ampicillin PMID:24336569 The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:13 8
Human Lentiviral sgRNA Library - Unknown Function
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51043 sgRNA library (enriched for genes of unknown function) Homo sapiens Ampicillin PMID:24336569 The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below. Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The PRECISE-TBI toolbox are a collection tools and resources to increase rigor and reproducibility with Traumatic Brain Injury within the PRE Clinical Interagency reSearch resourcE - Traumatic Brain Injury (PRECISE-TBI). Please learn more about PRECISE-TBI at https://www.precise-tbi.org

Recent News Entries

Contact Us

Department of Neurosciences, School of Medicine

University of California, San Diego





About SciCrunch | Privacy Policy | Terms of Service

SciCrunch