Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:13909; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39762235
Proper citation: RRID:Addgene_216394 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-210-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103346 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-210-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103347 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-338-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103450 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SMT3
Vector Backbone Description: Backbone Size:3462; Vector Backbone:pQE30 (QIAGEN); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:12761287
Proper citation: RRID:Addgene_16232 Copy
Vector Backbone Description: Vector Backbone:pJOE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:34175462
Comments: Please note that the Addgene verified sequence differs from the depositor's reference sequence linked under the supplemental documents section. These differences do not alter the plasmid function.
Proper citation: RRID:Addgene_169872 Copy
Species: Other
Genetic Insert: OsTIR1
Vector Backbone Description: Vector Backbone:pDB4697; Vector Types:Other; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:34849776
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.19.452993v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_171126 Copy
Species: Mus musculus
Genetic Insert: 3 tandem zinc fingers
Vector Backbone Description: Backbone Size:3890; Vector Backbone:ColE1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:18500337
Proper citation: RRID:Addgene_18752 Copy
Species: Mus musculus
Genetic Insert: 3 tandem zinc fingers
Vector Backbone Description: Backbone Size:3890; Vector Backbone:ColE1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:18500337
Proper citation: RRID:Addgene_18753 Copy
Species: Mus musculus
Genetic Insert: 3 tandem zinc fingers
Vector Backbone Description: Backbone Size:3890; Vector Backbone:ColE1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:18500337
Proper citation: RRID:Addgene_18756 Copy
Species: Streptomyces phage phiC31
Genetic Insert: phiC31 attP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3905; Vector Backbone:pCR2.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:10801973
Proper citation: RRID:Addgene_18939 Copy
Vector Backbone Description: Vector Backbone:pPMQAK1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:30819783
Comments: Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_119559 Copy
Genetic Insert: N terminal avi tag with RBS
Vector Backbone Description: Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26008 Copy
Genetic Insert: N terminal Strep tag with RBS
Vector Backbone Description: Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26015 Copy
Genetic Insert: N terminal VSV tag with RBS
Vector Backbone Description: Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26018 Copy
Genetic Insert: N terminal V5 tag with RBS
Vector Backbone Description: Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26017 Copy
Genetic Insert: N terminal HSV tag with RBS
Vector Backbone Description: Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26012 Copy
Genetic Insert: N terminal HA tag with RBS
Vector Backbone Description: Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26011 Copy
Genetic Insert: N terminal Flag tag with RBS
Vector Backbone Description: Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26010 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Med7 aa102-205 for C-terminal tagging
Vector Backbone Description: Backbone Size:2852; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26184 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.