Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5000; Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23651248
Proper citation: RRID:Addgene_49796 Copy
Genetic Insert: genotype: rpsL, thr, leu, thi, lacY, galK, galT, ara, tomA, tsx, dam, dcm, supE44, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:2985470
Proper citation: RRID:Addgene_49763 Copy
Species: Homo sapiens
Genetic Insert: SUMO-1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52258 Copy
Species: Homo sapiens
Genetic Insert: SUMO-3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52263 Copy
Species: Homo sapiens
Genetic Insert: SUMO-1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52261 Copy
Species: Escherichia coli K-12 W3110
Genetic Insert: E.coli Type I-E CRISPR cas
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:2300; Vector Backbone:pCDF; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:41290661
Proper citation: RRID:Addgene_247069 Copy
Species: Synthetic
Genetic Insert: T0 terminator - Sm resistance cassette
Vector Backbone Description: Backbone Size:4948; Vector Backbone:pSH624-ssr; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37798358
Proper citation: RRID:Addgene_198026 Copy
Species: E. coli
Genetic Insert: dnaQ
Vector Backbone Description: Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_241263 Copy
Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Removal of Anthoceros agrestis RbcX2 and RbcX1 from pCDF_AaRaf1/Raf2/RbcX2/BSD2/RbcX1 was performed by Genscript.
Proper citation: RRID:Addgene_229515 Copy
Species: Arabidopsis thaliana
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Gene Synthesis from Genscript. Design of the Rubisco assembly factor inserts was mirroring pAtR1/R2/RX/B2 as shown in Aigner et al 2017 (10.1126/science.aap9221), with the addition of RbcX isoform, RbcXI after the BSD2 gene.
Proper citation: RRID:Addgene_229510 Copy
Species: Arabidopsis thaliana
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Gene Synthesis from Genscript. Design of the three Rubisco assembly factor inserts was mirroring pAtR1/R2/RX/B2 as shown in Aigner et al 2017 (10.1126/science.aap9221).
Proper citation: RRID:Addgene_229511 Copy
Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Removal of Anthoceros agrestis Raf2 from pCDF_AaRaf1/Raf2/RbcX2/BSD2/RbcX1 was performed by Genscript.
Proper citation: RRID:Addgene_229513 Copy
Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Fragments of assembly factors , with T7 promoter and terminator, with type II restriction cut sites at both ends were ordered from Twist Bioscience, construct was formed with a golden gate pot reaction to an receiver pCDF backbone.
Proper citation: RRID:Addgene_229507 Copy
Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Gene Synthesis from Genscript. Each assembly factor is regulated by a individual T7 promoter and terminator.
Proper citation: RRID:Addgene_229509 Copy
Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Fragments of assembly factors , with T7 promoter and terminator, with type II restriction cut sites at both ends were ordered from Twist Bioscience, construct was formed with a golden gate pot reaction to an receiver pCDF backbone.
Proper citation: RRID:Addgene_229508 Copy
Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40645610
Proper citation: RRID:Addgene_229736 Copy
Species: Synthetic
Genetic Insert: msfGFP
Vector Backbone Description: Backbone Size:4730; Vector Backbone:pBAMD1-4; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39778677
Proper citation: RRID:Addgene_227664 Copy
Species: Chryseobacterium sp. JM1
Genetic Insert: ChrH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37252350
Comments: Also encodes ChrI (no tag)
Proper citation: RRID:Addgene_225083 Copy
Species: BxbI phage
Genetic Insert: SmR
Vector Backbone Description: Backbone Size:6370; Vector Backbone:pFNC-6; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39778677
Proper citation: RRID:Addgene_227668 Copy
Genetic Insert: Genotype: MC4100 ∆clpPX
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27732583
Comments: Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).
The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.
Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).
Proper citation: RRID:Addgene_98417 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
