Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 177,820 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/51092

Species: Synthetic
Genetic Insert: oChIEF(E163A/T199C)
Vector Backbone Description: Backbone Marker:custom; Backbone Size:5100; Vector Backbone:pAAV-CaMKIIa-WPRE-HGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: The addition of the E163A and T199C mutations in oChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.

Proper citation: RRID:Addgene_51092 Copy   


  • RRID:Addgene_51135

    This resource has 1+ mentions.

http://www.addgene.org/51135

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8089; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25051498

Proper citation: RRID:Addgene_51135 Copy   


http://www.addgene.org/51095

Species: Synthetic
Genetic Insert: ChIEF(E162A/T198C)
Vector Backbone Description: Backbone Marker:custom; Backbone Size:1047; Vector Backbone:pAAV-EF1a-DIO-WPRE-BGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: The addition of the E162A and T198C mutations in ChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.

Proper citation: RRID:Addgene_51095 Copy   


  • RRID:Addgene_51131

    This resource has 1+ mentions.

http://www.addgene.org/51131

Species: Homo sapiens
Genetic Insert: ubc13
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5800; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22367539

Proper citation: RRID:Addgene_51131 Copy   


http://www.addgene.org/51137

Species: Homo sapiens
Genetic Insert: Cin85
Vector Backbone Description: Backbone Marker:Origene; Backbone Size:6600; Vector Backbone:pCMV6-AN-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments:

Proper citation: RRID:Addgene_51137 Copy   


http://www.addgene.org/50960

Genetic Insert: DsRed
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pBBRBB; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24509770

Proper citation: RRID:Addgene_50960 Copy   


http://www.addgene.org/50962

Genetic Insert: DsRed
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pBBRBB; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24509770

Proper citation: RRID:Addgene_50962 Copy   


  • RRID:Addgene_51138

    This resource has 1+ mentions.

http://www.addgene.org/51138

Species: S.aureus
Genetic Insert: S.aureus SrtA delta 59
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23989673

Proper citation: RRID:Addgene_51138 Copy   


http://www.addgene.org/51144

Species: Synthetic
Genetic Insert: NOSp-NPTII-OCST
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH47732; Vector Types:; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_51144 Copy   


  • RRID:Addgene_51025

    This resource has 1+ mentions.

http://www.addgene.org/51025

Species: Homo sapiens
Genetic Insert: optimized sgRNA
Vector Backbone Description: Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24360272
Comments: gRNA target sequence GTGGCGTGACCTGTGGATGCTG

Proper citation: RRID:Addgene_51025 Copy   


  • RRID:Addgene_51024

    This resource has 10+ mentions.

http://www.addgene.org/51024

Species: Homo sapiens
Genetic Insert: Optimized sgRNA
Vector Backbone Description: Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24360272
Comments: gRNA target sequence GTTAGGGTTAGGGTTAGGGTTA

Proper citation: RRID:Addgene_51024 Copy   


http://www.addgene.org/51145

Species: Synthetic
Genetic Insert: NOSp-BAR-NOST
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH47732; Vector Types:; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_51145 Copy   


  • RRID:Addgene_51142

    This resource has 10+ mentions.

http://www.addgene.org/51142

Genetic Insert: hCas9
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:5800; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24084724

Proper citation: RRID:Addgene_51142 Copy   


  • RRID:Addgene_51141

    This resource has 10+ mentions.

http://www.addgene.org/51141

Species: S.aureus
Genetic Insert: S.aureus SrtA 7M
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5421; Vector Backbone:pET30b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_51141 Copy   


  • RRID:Addgene_50976

http://www.addgene.org/50976

Genetic Insert: oChD-citrine
Vector Backbone Description: Backbone Size:4599; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19254539
Comments: WPRE is inserted after the citrine before SV40 polyA.

Proper citation: RRID:Addgene_50976 Copy   


  • RRID:Addgene_50975

http://www.addgene.org/50975

Species: Synthetic
Genetic Insert: ChEF-citrine
Vector Backbone Description: Backbone Size:4599; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19254539
Comments: WPRE is inserted after the citrine before SV40 polyA.

Proper citation: RRID:Addgene_50975 Copy   


  • RRID:Addgene_50977

    This resource has 1+ mentions.

http://www.addgene.org/50977

Species: Synthetic
Genetic Insert: ChIEF-tdTomato
Vector Backbone Description: Backbone Size:4599; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19254539

Proper citation: RRID:Addgene_50977 Copy   


  • RRID:Addgene_51148

http://www.addgene.org/51148

Species: Escherichia coli
Genetic Insert: AcrR
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24316737
Comments: UCSF Case No. SF11-016-2; U.S. Patent Application 13/489,205. GeneArt inserted the synthesized fragment into a pET21a vector.

Proper citation: RRID:Addgene_51148 Copy   


  • RRID:Addgene_51035

http://www.addgene.org/51035

Species: Homo sapiens
Genetic Insert: MID2
Vector Backbone Description: Backbone Marker:Cox lab; Vector Backbone:pCMV-N2-6Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11806752
Comments: Please note: hMID2 begins at residue 19 of the NCBI reference sequence.

Proper citation: RRID:Addgene_51035 Copy   


  • RRID:Addgene_50989

http://www.addgene.org/50989

Species: Homo sapiens
Genetic Insert: RALB
Vector Backbone Description: Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056301

Proper citation: RRID:Addgene_50989 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X