Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: EL222 codon-optimized for budding yeast
Vector Backbone Description: Vector Backbone:EZL105; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: For a single-copy integration in budding yeast, the plasmid should be cut with PmeI (double-cutter). Please visit https://doi.org/10.1101/2024.02.28.582517 for bioRxiv preprint.
Proper citation: RRID:Addgene_227770 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Sgd1
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29054886
Comments: Addgene NGS results found T307A, S332F, and V832F in the Sgd1 translation compared to the best-match NCBI reference sequence (GAA25198.1).
Proper citation: RRID:Addgene_100000 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b
Vector Backbone Description: Vector Backbone:p426; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27899650
Proper citation: RRID:Addgene_87387 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Mitochondrial FAD-linked sulfhydryl oxidase
Vector Backbone Description: Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_176405 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dhr1
Vector Backbone Description: Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29054886
Comments: Addgene NGS results found S1073N, and an extra 16 amino acids at the C-terminus of the Dhr1 translation compared to NP_013847.1.
Proper citation: RRID:Addgene_100003 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dhr1
Vector Backbone Description: Vector Backbone:pAS2-1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29054886
Comments: Addgene NGS results found S1073N, and an extra 30 amino acids at the C-terminus of the Dhr1 translation compared to NP_013847.1.
Proper citation: RRID:Addgene_100002 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: gRNA library targeting yeast genes
Vector Backbone Description: Backbone Marker:Addgene 35452; Vector Backbone:pRS41x; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33757429
Proper citation: RRID:Addgene_161769 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SMT3
Vector Backbone Description: Backbone Size:3462; Vector Backbone:pQE30 (QIAGEN); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:12761287
Proper citation: RRID:Addgene_16232 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CDC3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11577116
Proper citation: RRID:Addgene_16252 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding sites (first HLM, and 5 additional HLMs in C-terminal domain).
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163582 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: C-terminal domain (327-970) containing 5 impaired Edc3 binding sites (5 additional HLMs in C-terminal domain); N-terminal domain (1-299) including first HLM is removed.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163581 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163585 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding site (first HLM); impaired RNA cap recognition site (W50, D54).
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163580 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163574 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Lacking C-terminal domain.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163577 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MatA
Vector Backbone Description: Vector Backbone:pCR™-Blunt II-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29150593
Proper citation: RRID:Addgene_169457 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: gRNA for MATα
Vector Backbone Description: Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29150593
Proper citation: RRID:Addgene_169454 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ecm2 1-143
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:5000; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33547186
Proper citation: RRID:Addgene_169923 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ecm2 1-325
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:5000; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33547186
Proper citation: RRID:Addgene_169926 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: U6 U57A
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4783; Vector Backbone:pRS314; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33547186
Comments: Please note that this plasmid contains an additional IS4-like element ISVsa5 family transposase compared to the pRS314 backbone.
Proper citation: RRID:Addgene_169927 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
