Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
https://dgrc.bio.indiana.edu/product/View?product=1381486
Species: Drosophila melanogaster
Defining Citation: PMID:16326860
Comments: BDGP iPCR Collection
Proper citation: RRID:DGRC_1381486 Copy
https://dgrc.bio.indiana.edu/product/View?product=1604016
Species: Drosophila melanogaster
Defining Citation: PMID:16326860
Comments: BDGP iPCR Collection
Proper citation: RRID:DGRC_1604016 Copy
Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Backbone Size:14873; Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Comments: Can be used to knockout the human CD20 gene, MS4A1. After which, pCDH-V1-rCD20-BSD, pCDH-V2-rCD20-BSD or pCDH-V3-rCD20-BSD can be used to reconstitute CD20 expression with either variants 1, 2 or 3 mRNA isoforms of CD20.
Proper citation: RRID:Addgene_209749 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Backbone Size:14873; Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Proper citation: RRID:Addgene_209750 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: YIp ADE2-LEU2 pTDH3::aro7-G141S-GFP::tADH1
Vector Backbone Description: Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37729018
Proper citation: RRID:Addgene_210178 Copy
Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Proper citation: RRID:Addgene_209759 Copy
Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Proper citation: RRID:Addgene_209756 Copy
Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Proper citation: RRID:Addgene_209757 Copy
Species: Homo sapiens
Genetic Insert: RILPL1
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38091401
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.06.07.544051v3 for bioRxiv preprint.
Proper citation: RRID:Addgene_201470 Copy
Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Size:7456; Vector Backbone:pCDH-IRES-BSD; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Comments: Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 1 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout.
Proper citation: RRID:Addgene_209752 Copy
Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Size:7456; Vector Backbone:pCDH-IRES-BSD; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Comments: Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 2 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout.
Proper citation: RRID:Addgene_209753 Copy
Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Size:7456; Vector Backbone:pCDH-IRES-BSD; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Comments: Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout.
Proper citation: RRID:Addgene_209754 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: YIp ADE2-LEU2 pTDH3::lys1-W353G-GFP::tADH1
Vector Backbone Description: Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37729018
Proper citation: RRID:Addgene_210181 Copy
Species: Selenomonas sp. isolate RGIG9219 Water_deer_Rumen (MAG), JAGBLH010000220
Genetic Insert: Cas8-HNH proteins and CRISPR array
Vector Backbone Description: Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37995242
Proper citation: RRID:Addgene_205966 Copy
Species: Homo sapiens
Genetic Insert: RPS2
Vector Backbone Description: Backbone Size:10863; Vector Backbone:pLIX403_Capture1_APOBEC_HA_P2A_mRuby; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33963355
Proper citation: RRID:Addgene_194703 Copy
Species: Synthetic
Genetic Insert: EGFP/BC12
Vector Backbone Description: Vector Backbone:pCER206; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37321219
Comments: Please note: Plasmid contains a M234K mutation in EGFP. This mutation is not expected to affect plasmid function.
Proper citation: RRID:Addgene_202853 Copy
Species: Sulfitobacter sp. JL08, NZ_CP025815
Genetic Insert: DinG HNH crRNA
Vector Backbone Description: Vector Backbone:pColADuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37995242
Proper citation: RRID:Addgene_205964 Copy
Species: Candidatus Cloacimonetes bacterium (MAG), MWEE01000013
Genetic Insert: Cas5-HNH proteins and CRISPR array
Vector Backbone Description: Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37995242
Proper citation: RRID:Addgene_205969 Copy
Species: Homo sapiens
Genetic Insert: PML (isoform IVa; 3MAS)
Vector Backbone Description: Vector Backbone:Derived from Addgene ID# 52962 (Zhang Lab).; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34795231
Comments: Control for PMLiva SUMO-ID experiments; 3MAS mutant lacks major SUMOylation sites and SIM domain.
Proper citation: RRID:Addgene_208039 Copy
Species: Homo sapiens
Genetic Insert: SUMO1nc
Vector Backbone Description: Backbone Marker:Open Biosystems; Vector Backbone:TRIPZ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34795231
Comments: Lentiviral packaging of TRIPZ is more efficient with TAT expression (e.g using pcDNA1-TatHIV Addgene ID: 138478) and 2nd generation gag/pol/env combination (e.g. using PSPAX2 Addgene ID: 12260 and pMD2.G Addgene ID: 12259); SUMO1nc is excisable using EcoR1-Mlu1.
Proper citation: RRID:Addgene_208035 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.