Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ubc13
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5800; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22367539
Proper citation: RRID:Addgene_51131 Copy
Species: Homo sapiens
Genetic Insert: Cin85
Vector Backbone Description: Backbone Marker:Origene; Backbone Size:6600; Vector Backbone:pCMV6-AN-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments:
Proper citation: RRID:Addgene_51137 Copy
Species: Homo sapiens
Genetic Insert: optimized sgRNA
Vector Backbone Description: Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24360272
Comments: gRNA target sequence GTGGCGTGACCTGTGGATGCTG
Proper citation: RRID:Addgene_51025 Copy
Species: Homo sapiens
Genetic Insert: Optimized sgRNA
Vector Backbone Description: Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24360272
Comments: gRNA target sequence GTTAGGGTTAGGGTTAGGGTTA
Proper citation: RRID:Addgene_51024 Copy
Species: Homo sapiens
Genetic Insert: MID2
Vector Backbone Description: Backbone Marker:Cox lab; Vector Backbone:pCMV-N2-6Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11806752
Comments: Please note: hMID2 begins at residue 19 of the NCBI reference sequence.
Proper citation: RRID:Addgene_51035 Copy
Species: Homo sapiens
Genetic Insert: RALB
Vector Backbone Description: Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056301
Proper citation: RRID:Addgene_50989 Copy
Species: Homo sapiens
Genetic Insert: RALB
Vector Backbone Description: Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056301
Proper citation: RRID:Addgene_50983 Copy
Species: Homo sapiens
Genetic Insert: RALB
Vector Backbone Description: Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056301
Proper citation: RRID:Addgene_50982 Copy
Species: Homo sapiens
Genetic Insert: sgRNA library (enriched for ribosomal targets)
Vector Backbone Description: Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters.
IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool.
The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below.
Proper citation: RRID:Addgene_51045 Copy
Species: Homo sapiens
Genetic Insert: sgRNA library (enriched for kinase targets)
Vector Backbone Description: Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters.
IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool.
The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below.
Proper citation: RRID:Addgene_51044 Copy
Species: Homo sapiens
Genetic Insert: sgRNA library (enriched for nuclear targets)
Vector Backbone Description: Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters.
IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool.
The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below.
Proper citation: RRID:Addgene_51047 Copy
Species: Homo sapiens
Genetic Insert: sgRNA library (enriched for genes of unknown function)
Vector Backbone Description: Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters.
IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool.
The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below.
Proper citation: RRID:Addgene_51043 Copy
Species: Homo sapiens
Genetic Insert: ARAF
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABEpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24569458
Proper citation: RRID:Addgene_51078 Copy
Species: Homo sapiens
Genetic Insert: CRAF
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABEpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_51126 Copy
Species: Homo sapiens
Genetic Insert: H2B-EGFP
Vector Backbone Description: Backbone Size:8344; Vector Backbone:pLenti.Syn(0.5).eGFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: Please note that the H2B sequence in this plasmid was derived from H2B-GFP (Addgene plasmid# 11680) and contains the same differences (D26G and V119I) compared to GenBank reference sequences, such as NP_066402.2.
Proper citation: RRID:Addgene_51004 Copy
Species: Homo sapiens
Genetic Insert: CRAF
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABEpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_51127 Copy
Species: Homo sapiens
Genetic Insert: homeobox A9
Vector Backbone Description: Backbone Marker:Dr. Richard Mulligan; Backbone Size:12152; Vector Backbone:pINDUCER21 (ORF-EG); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24094326
Comments: NOTE: The map and depositor sequence are of the empty backbone ONLY. Addgene does not have sequence for the fully assembled plasmid. Sequence for much of the insert can be found in Addgene's sequencing results.
Proper citation: RRID:Addgene_51302 Copy
Species: Homo sapiens
Genetic Insert: v-ets avian erythroblastosis virus E26 oncogene homolog
Vector Backbone Description: Backbone Marker:Dr. Richard Mulligan; Backbone Size:12152; Vector Backbone:pINDUCER21 (ORF-EG); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24094326
Comments: NOTE: The map and depositor sequence are of the empty backbone ONLY. Addgene does not have sequence for the fully assembled plasmid. Sequence for much of the insert can be found in Addgene's sequencing results.
Proper citation: RRID:Addgene_51301 Copy
Species: Homo sapiens
Genetic Insert: U6
Vector Backbone Description: Backbone Marker:Addgene plasmid 51283; Vector Backbone:pAluYa5-neo-TET; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19390602
Comments: U6 is tagged with the self splicing intron neo cassette such that G418 resistance will be obtained only if retrotransposition occurs.
Please note that the cassette is in the reverse orientation within the MCS relative to the full sequence--This has no functional consequence.
Proper citation: RRID:Addgene_51286 Copy
Species: Homo sapiens
Genetic Insert: L1 ORF2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:21572950
Comments: This plasmid was created using the codon optimized L1RP as a source for the ORF2 coding sequence.
Proper citation: RRID:Addgene_51289 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.