Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 69,655 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_51131

    This resource has 1+ mentions.

http://www.addgene.org/51131

Species: Homo sapiens
Genetic Insert: ubc13
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5800; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22367539

Proper citation: RRID:Addgene_51131 Copy   


http://www.addgene.org/51137

Species: Homo sapiens
Genetic Insert: Cin85
Vector Backbone Description: Backbone Marker:Origene; Backbone Size:6600; Vector Backbone:pCMV6-AN-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments:

Proper citation: RRID:Addgene_51137 Copy   


  • RRID:Addgene_51025

    This resource has 1+ mentions.

http://www.addgene.org/51025

Species: Homo sapiens
Genetic Insert: optimized sgRNA
Vector Backbone Description: Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24360272
Comments: gRNA target sequence GTGGCGTGACCTGTGGATGCTG

Proper citation: RRID:Addgene_51025 Copy   


  • RRID:Addgene_51024

    This resource has 10+ mentions.

http://www.addgene.org/51024

Species: Homo sapiens
Genetic Insert: Optimized sgRNA
Vector Backbone Description: Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24360272
Comments: gRNA target sequence GTTAGGGTTAGGGTTAGGGTTA

Proper citation: RRID:Addgene_51024 Copy   


  • RRID:Addgene_51035

http://www.addgene.org/51035

Species: Homo sapiens
Genetic Insert: MID2
Vector Backbone Description: Backbone Marker:Cox lab; Vector Backbone:pCMV-N2-6Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11806752
Comments: Please note: hMID2 begins at residue 19 of the NCBI reference sequence.

Proper citation: RRID:Addgene_51035 Copy   


  • RRID:Addgene_50989

http://www.addgene.org/50989

Species: Homo sapiens
Genetic Insert: RALB
Vector Backbone Description: Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056301

Proper citation: RRID:Addgene_50989 Copy   


http://www.addgene.org/50983

Species: Homo sapiens
Genetic Insert: RALB
Vector Backbone Description: Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056301

Proper citation: RRID:Addgene_50983 Copy   


http://www.addgene.org/50982

Species: Homo sapiens
Genetic Insert: RALB
Vector Backbone Description: Vector Backbone:pLA; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056301

Proper citation: RRID:Addgene_50982 Copy   


http://www.addgene.org/51045

Species: Homo sapiens
Genetic Insert: sgRNA library (enriched for ribosomal targets)
Vector Backbone Description: Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below.

Proper citation: RRID:Addgene_51045 Copy   


http://www.addgene.org/51044

Species: Homo sapiens
Genetic Insert: sgRNA library (enriched for kinase targets)
Vector Backbone Description: Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below.

Proper citation: RRID:Addgene_51044 Copy   


http://www.addgene.org/51047

Species: Homo sapiens
Genetic Insert: sgRNA library (enriched for nuclear targets)
Vector Backbone Description: Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below.

Proper citation: RRID:Addgene_51047 Copy   


http://www.addgene.org/51043

Species: Homo sapiens
Genetic Insert: sgRNA library (enriched for genes of unknown function)
Vector Backbone Description: Backbone Marker:based on pLX304 (Root lab); Backbone Size:7500; Vector Backbone:pLX-sgRNA; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: The library is supplied as pooled DNA. You will receive 1 microgram of DNA in a volume of ~20 microliters. IMPORTANT NOTE: Though each sub-pool is enriched for its respective target sgRNAs, they are not exclusive and elements of the entire library may be present in each sub-pool. The backbone of this library is pLX-sgRNA (http://www.addgene.org/50662). See map below.

Proper citation: RRID:Addgene_51043 Copy   


  • RRID:Addgene_51078

http://www.addgene.org/51078

Species: Homo sapiens
Genetic Insert: ARAF
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABEpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24569458

Proper citation: RRID:Addgene_51078 Copy   


  • RRID:Addgene_51126

http://www.addgene.org/51126

Species: Homo sapiens
Genetic Insert: CRAF
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABEpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_51126 Copy   


  • RRID:Addgene_51004

    This resource has 1+ mentions.

http://www.addgene.org/51004

Species: Homo sapiens
Genetic Insert: H2B-EGFP
Vector Backbone Description: Backbone Size:8344; Vector Backbone:pLenti.Syn(0.5).eGFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: Please note that the H2B sequence in this plasmid was derived from H2B-GFP (Addgene plasmid# 11680) and contains the same differences (D26G and V119I) compared to GenBank reference sequences, such as NP_066402.2.

Proper citation: RRID:Addgene_51004 Copy   


  • RRID:Addgene_51127

    This resource has 1+ mentions.

http://www.addgene.org/51127

Species: Homo sapiens
Genetic Insert: CRAF
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABEpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_51127 Copy   


  • RRID:Addgene_51302

http://www.addgene.org/51302

Species: Homo sapiens
Genetic Insert: homeobox A9
Vector Backbone Description: Backbone Marker:Dr. Richard Mulligan; Backbone Size:12152; Vector Backbone:pINDUCER21 (ORF-EG); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24094326
Comments: NOTE: The map and depositor sequence are of the empty backbone ONLY. Addgene does not have sequence for the fully assembled plasmid. Sequence for much of the insert can be found in Addgene's sequencing results.

Proper citation: RRID:Addgene_51302 Copy   


  • RRID:Addgene_51301

http://www.addgene.org/51301

Species: Homo sapiens
Genetic Insert: v-ets avian erythroblastosis virus E26 oncogene homolog
Vector Backbone Description: Backbone Marker:Dr. Richard Mulligan; Backbone Size:12152; Vector Backbone:pINDUCER21 (ORF-EG); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24094326
Comments: NOTE: The map and depositor sequence are of the empty backbone ONLY. Addgene does not have sequence for the fully assembled plasmid. Sequence for much of the insert can be found in Addgene's sequencing results.

Proper citation: RRID:Addgene_51301 Copy   


  • RRID:Addgene_51286

    This resource has 1+ mentions.

http://www.addgene.org/51286

Species: Homo sapiens
Genetic Insert: U6
Vector Backbone Description: Backbone Marker:Addgene plasmid 51283; Vector Backbone:pAluYa5-neo-TET; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19390602
Comments: U6 is tagged with the self splicing intron neo cassette such that G418 resistance will be obtained only if retrotransposition occurs. Please note that the cassette is in the reverse orientation within the MCS relative to the full sequence--This has no functional consequence.

Proper citation: RRID:Addgene_51286 Copy   


  • RRID:Addgene_51289

    This resource has 1+ mentions.

http://www.addgene.org/51289

Species: Homo sapiens
Genetic Insert: L1 ORF2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:21572950
Comments: This plasmid was created using the codon optimized L1RP as a source for the ORF2 coding sequence.

Proper citation: RRID:Addgene_51289 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X