Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
OmEF1aCas9P2ApuroSB Resource Report Resource Website |
RRID:Addgene_165484 | Zebrafish optimized Cas9 (nls-zcas9-nls from Wenbiao Chen Lab plasmid pCS2-nCas9n Addgene #47929) | Synthetic | Ampicillin | PMID:33846462 | Backbone Marker:Eric Kowarz Lab (Addgene #60511); Backbone Size:6640; Vector Backbone:pSBbi-GP; Vector Types:CRISPR, Transposon; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:27 | 0 | ||
|
pRB30 Resource Report Resource Website |
RRID:Addgene_165480 | Ampicillin | PMID:24510647 | Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add GATTGGAAGTAGAGGTTCTCTGC to the 3' end of GOI. For vector: digest with BfuAI (BspMI) before LIC-treatment. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34. | Backbone Marker:Novagen; Vector Backbone:pTriEx-1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:33 | 0 | |||
|
pRB30-GFP Resource Report Resource Website |
RRID:Addgene_165481 | Ampicillin | PMID:24510647 | Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add GATTGGAAGTAGAGGTTCTCTGC to the 3' end of GOI. For vector: digest with BfuAI (BspMI) before LIC-treatment. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34. | Backbone Marker:Novagen; Vector Backbone:pTriEx-1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:27 | 0 | |||
|
pCMV3Tag8li-hMBOAT7-3xFLAG Resource Report Resource Website |
RRID:Addgene_165474 | Membrane bound O-acyltransferase domain containing 7 | Homo sapiens | Ampicillin | PMID:21903422 | Backbone contains new MCS (multiple cloning site). CDS without stop codon was inserted with XhoI-NotI and it expresses in frame with 3xFLAG epitope tag. Construct insertion = Xhoi-GCC-[MBOAT7 CDS 1416 bp, no stop]-Noti-A-Clai-GTCGAG-3xFLAG-STOP | Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:26 | 0 | |
|
pC23-LIC-His-FLAG Resource Report Resource Website |
RRID:Addgene_165477 | Ampicillin | PMID:24510647 | Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add TGAAAATAGAGGTTTTCGGC to the 3' end of GOI. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34. | Backbone Marker:Novagen; Vector Backbone:pET23; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:26 | 0 | |||
|
pN23-LIC-His-FLAG Resource Report Resource Website |
RRID:Addgene_165478 | Ampicillin | PMID:24510647 | Primers for LIC cloning: Upstream: add TATTTTCAATCCTACGTA to the 5' end of gene of interest. Downstream: add CCCTCAATATTATACGGG to the 3' end of GOI. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34. | Backbone Marker:Novagen; Vector Backbone:pET23; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:33 | 0 | |||
|
pCMV3Tag8li-hADARB2-3xFLAG Resource Report Resource Website |
RRID:Addgene_165470 | Adenosine deaminase RNA specific B2 (inactive) | Homo sapiens | Ampicillin | PMID:24778252 | Backbone contains new MCS (multiple cloning site). MCS is changed to: ctcgagctgaagcttcatggatccaaagcggccgcaatcgat (XhoI-ctg-HindIII-cat-BamHI-aaa-NotI-a-ClaI). CDS without stop codon was inserted into MCS at unkown restriction enzyme sites, and it expresses in frame with 3xFLAG epitope tag. Xhoi was probably the 5' cloning site. | Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:26 | 0 | |
|
pTargeting_Mettl3C_FKBP-V Resource Report Resource Website |
RRID:Addgene_165421 | Mettl3 C-terminus + linker + FKBP-V | Mus musculus | Ampicillin | PMID:34131006 | Vector Backbone:None; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:26 | 0 | ||
|
pGST-PPARgamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_16549 | PPAR gamma | Homo sapiens | Ampicillin | PMID:10555149 | Note that there are some discrepancies between the insert in this plasmid and the canonical GenBank PPARgamma. The Vogelstein lab maintains that this plasmid worked as specified when they made and used it. | Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | N-terminal DNA-binding domain: aa 1-248 | 2026-08-01 01:07:27 | 2 |
|
pSico_U6-PGC1a1 sgRNA Resource Report Resource Website |
RRID:Addgene_165425 | gRNA against PGC-1a variant 1 | Homo sapiens | Ampicillin | PMID:33626346 | Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:26 | 0 | ||
|
pBI-p73 wt/EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_16545 | p73 | Homo sapiens | Ampicillin | PMID:10588737 | Tet-responsive p73 expression construct. | Backbone Size:5210; Vector Backbone:pBI-MCS-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:26 | 1 | |
|
pBI-MCS-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_16542 | Ampicillin | PMID:10588737 | The tet-responsive reporter plasmid pBI-EGFP was purchased from Clontech and modified by the inclusion of a polylinker to create pBI-MCS-EGFP. | Backbone Size:5210; Vector Backbone:pBI-MCS-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:26 | 9 | |||
|
tTA-IRES-Neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_16541 | tTA | Ampicillin | PMID:10588737 | tTA is a a tetracycline-controlled transactivator generated by fusing the tet repressor with the activating domain of virion protein 16 of herpes simplex virus. tTA-IRES-Neo was generated by cloning PCR-amplified tTA cDNA from pUHD15-1 (Gossen, M. & Bujard, H., 1992, PNAS 89, 5547-5551) into the XbaI site of plasmid pMk10-59 (Kobayashi, M et al., 1996, Biotechniques 21, 398-402). | Backbone Size:6000; Vector Backbone:pMk10-59; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:33 | 1 | ||
|
MSCV-Tox2-IRES-eGFP Resource Report Resource Website |
RRID:Addgene_165428 | TOX2 | Mus musculus | Ampicillin | PMID:31152140 | Backbone Marker:Tannishtha Reya Lab; Backbone Size:6400; Vector Backbone:MSCV-IRES-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:26 | 0 | ||
|
pSico_U6-Pan-PGC1a sgRNA Resource Report Resource Website |
RRID:Addgene_165426 | gRNA against human Total PGC-1a variants | Homo sapiens | Ampicillin | PMID:33626346 | Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:33 | 0 | ||
|
pAAV-syn-SnFR-gamma8-minWPRE Resource Report Resource Website |
RRID:Addgene_165498 | iGluSnFR extracellular domain fused to TARP gamma-8 via NETO2 TM domain | Rattus norvegicus | Ampicillin | PMID:36622100 | Chimera of iGluSnFR (Addgene plasmid # 41732), Neto2 and Gamma-8 pAAV backbone is based on Addgene plasmid # 61463 Please visit https://doi.org/10.1101/2021.01.21.427382 for bioRxiv preprint. | Backbone Size:3950; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:27 | 0 | |
|
pMMB206-CT81 Resource Report Resource Website |
RRID:Addgene_165411 | CT81 gene circuit | Synthetic | Chloramphenicol | PMID:33558556 | pMMB206 backbone is very low copy, <10 copies. | Backbone Size:9311; Vector Backbone:pMMB206; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-08-01 01:07:26 | 0 | |
|
pGEM-HE-Glyco-Venus-bPAC(S27A) Resource Report Resource Website |
RRID:Addgene_165490 | Glyco-Venus-bPAC(S27A)-Myc | Synthetic | Ampicillin | PMID:34663304 | Backbone Size:3009; Vector Backbone:pGEM HE; Vector Types:Bacterial Expression, cDNA expression, Xenopus Oocyte; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:27 | 0 | ||
|
pGST-PPARalpha Resource Report Resource Website |
RRID:Addgene_16550 | PPAR alpha | Homo sapiens | Ampicillin | PMID:10555149 | Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | N-terminal DNA-binding domain: aa 1-249 | 2026-08-01 01:07:33 | 0 | |
|
pSIN-TRE-H2BeGFP-rtTA2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_165494 | Human histone H2B | Homo sapiens | Ampicillin | PMID:29944140 | ABOUT BACKBONE: The lentiviral backbone was originally designed and constructed by Barde I et al. (Barde I et al. Mol Ther. 2006. 13(2): 382-90. PMID: 16275162). ABOUT TEST DIGESTION: Since Xba I restriction site is lost during cloning, we recommend checking the plasmid using the enzymes: Xho I and Nhe I. You should get two fragments around 1600 bp (insert+vector) and 7500 bp (vector). | Backbone Marker:-; Backbone Size:8023; Vector Backbone:pRRL-cPPT-hPGKTMPrtTA-WPRE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | - | 2026-08-01 01:07:33 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
