Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: Rac2
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52236 Copy
Species: Drosophila melanogaster
Genetic Insert: Ras85D
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52246 Copy
Species: Drosophila melanogaster
Genetic Insert: Ras64B
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52243 Copy
Species: Drosophila melanogaster
Genetic Insert: Ras64B
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52244 Copy
Species: Drosophila melanogaster
Genetic Insert: Ras85D
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52242 Copy
Species: Homo sapiens
Genetic Insert: Ska3
Vector Backbone Description: Backbone Marker:Addgene Plasmid # 44432; Backbone Size:5500; Vector Backbone:pIC242; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19289083
Proper citation: RRID:Addgene_52257 Copy
Species: Arabidopsis thaliana
Genetic Insert: guide RNA targeting AtPDS3
Vector Backbone Description: Backbone Size:3162; Vector Backbone:pUC119; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23929339
Comments: gRNA target sequence GGACTTTTGCCAGCCATGGT
This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper.
Proper citation: RRID:Addgene_52255 Copy
Species: Drosophila melanogaster
Genetic Insert: Mtl
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52252 Copy
Species: Drosophila melanogaster
Genetic Insert: Cdc42
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Comments: Please note that the ORF contains a SNP at A172T.
Proper citation: RRID:Addgene_52250 Copy
Species: Homo sapiens
Genetic Insert: SUMO-1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52258 Copy
Species: Mus musculus
Genetic Insert: TDG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52267 Copy
Species: Mus musculus
Genetic Insert: TDG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52268 Copy
Species: Homo sapiens
Genetic Insert: SUMO-3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52263 Copy
Species: Homo sapiens
Genetic Insert: SUMO-1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52261 Copy
Species: Homo sapiens
Genetic Insert: hTDG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52271 Copy
Species: Homo sapiens
Genetic Insert: XRCC1
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52276 Copy
Species: Homo sapiens
Genetic Insert: XRCC1
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4983; Vector Backbone:pGEX-6P-3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52275 Copy
Species: Homo sapiens
Genetic Insert: hTDG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52273 Copy
Species: Homo sapiens
Genetic Insert: hTDG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:7194; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52281 Copy
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:7194; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52280 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.