Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,718 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pUASp YFP Rac2 WT
 
Resource Report
Resource Website 		RRID:Addgene_52236 Rac2 Drosophila melanogaster Ampicillin Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin 2026-08-01 01:14:33 0
pUASp YFP Ras85D DN
 
Resource Report
Resource Website 		RRID:Addgene_52246 Ras85D Drosophila melanogaster Ampicillin Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin S17N; DN mutation 2026-08-01 01:14:33 0
pUASp YFP Ras64B DN
 
Resource Report
Resource Website 		RRID:Addgene_52243 Ras64B Drosophila melanogaster Ampicillin Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin S19N; DN mutation 2026-08-01 01:14:32 0
pUASp YFP Ras64B CA
 
Resource Report
Resource Website 		RRID:Addgene_52244 Ras64B Drosophila melanogaster Ampicillin Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin Q63L; CA mutation 2026-08-01 01:14:33 0
pUASp YFP Ras85D WT
 
Resource Report
Resource Website 		RRID:Addgene_52242 Ras85D Drosophila melanogaster Ampicillin Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin 2026-08-01 01:14:33 0
pIC306
 
Resource Report
Resource Website 		RRID:Addgene_52257 Ska3 Homo sapiens Ampicillin PMID:19289083 Backbone Marker:Addgene Plasmid # 44432; Backbone Size:5500; Vector Backbone:pIC242; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-01 01:14:33 0
pUC119-gRNA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_52255 guide RNA targeting AtPDS3 Arabidopsis thaliana Ampicillin PMID:23929339 gRNA target sequence GGACTTTTGCCAGCCATGGT This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper. Backbone Size:3162; Vector Backbone:pUC119; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:33 6
pUASp YFP Mtl DN
 
Resource Report
Resource Website 		RRID:Addgene_52252 Mtl Drosophila melanogaster Ampicillin Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin T20N; DN mutation 2026-08-01 01:14:33 0
pUASp YFP Cdc42 CA
 
Resource Report
Resource Website 		RRID:Addgene_52250 Cdc42 Drosophila melanogaster Ampicillin Please note that the ORF contains a SNP at A172T. Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin Q61L; CA mutation 2026-08-01 01:14:33 0
pSUMO1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_52258 SUMO-1 Homo sapiens Streptomycin PMID:25007328 Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin C-terminal gly-gly 2026-08-01 01:14:33 6
pTG-mTDG-K341R
 
Resource Report
Resource Website 		RRID:Addgene_52267 TDG Mus musculus Ampicillin PMID:25007328 Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin K341R, SUMO acceptor site mutation 2026-08-01 01:14:33 0
pSC-mTDG-IntE2
 
Resource Report
Resource Website 		RRID:Addgene_52268 TDG Mus musculus Ampicillin PMID:25007328 Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:33 0
pSA3
 
Resource Report
Resource Website 		RRID:Addgene_52263 SUMO-3 Homo sapiens Streptomycin PMID:25007328 Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin C-terminal gly-gly 2026-08-01 01:14:33 0
pSA1
 
Resource Report
Resource Website 		RRID:Addgene_52261 SUMO-1 Homo sapiens Streptomycin PMID:25007328 Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin C-terminal gly-gly 2026-08-01 01:14:33 0
pSC-hTDG-K330A-IntE2
 
Resource Report
Resource Website 		RRID:Addgene_52271 hTDG Homo sapiens Ampicillin PMID:25007328 Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin K330A, SUMO acceptor site mutation 2026-08-01 01:14:33 0
pSC-hXRCC1-IntE2
 
Resource Report
Resource Website 		RRID:Addgene_52276 XRCC1 Homo sapiens Ampicillin PMID:25007328 Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:33 0
pGEX-hXRCC1-K176R
 
Resource Report
Resource Website 		RRID:Addgene_52275 XRCC1 Homo sapiens Ampicillin PMID:25007328 Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4983; Vector Backbone:pGEX-6P-3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin K176R, SUMO acceptor site mutant 2026-08-01 01:14:33 0
pSC-hTDG-K330A-PreE2
 
Resource Report
Resource Website 		RRID:Addgene_52273 hTDG Homo sapiens Ampicillin PMID:25007328 Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin K330A, SUMO acceptor site mutation 2026-08-01 01:14:33 0
pTXG-hTDG
 
Resource Report
Resource Website 		RRID:Addgene_52281 hTDG Homo sapiens Ampicillin PMID:25007328 Backbone Marker:New England Biolabs; Backbone Size:7194; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:33 0
pTXG
 
Resource Report
Resource Website 		RRID:Addgene_52280 Ampicillin PMID:25007328 Backbone Marker:New England Biolabs; Backbone Size:7194; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:33 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The PRECISE-TBI toolbox are a collection tools and resources to increase rigor and reproducibility with Traumatic Brain Injury within the PRE Clinical Interagency reSearch resourcE - Traumatic Brain Injury (PRECISE-TBI). Please learn more about PRECISE-TBI at https://www.precise-tbi.org

Recent News Entries

Contact Us

Department of Neurosciences, School of Medicine

University of California, San Diego





About SciCrunch | Privacy Policy | Terms of Service

SciCrunch