Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:streptomycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

228 Results - per page

Show More Columns | Download 228 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pJK567
 
Resource Report
Resource Website 		RRID:Addgene_72522 hypothetical protein in purSQL operon Acetobacter aceti 1023 Streptomycin pCloDF13 replicon Contains additional (repeated?) sequence in 3' UTR of cassette 1. Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin contains additional Ala2 2026-08-29 01:09:53 0
pJK554
 
Resource Report
Resource Website 		RRID:Addgene_72453 N5-carboxyaminoimidazole ribonucleotide mutase Acetobacter aceti 1023 Streptomycin Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:09:52 0
pJK552
 
Resource Report
Resource Website 		RRID:Addgene_72451 N5-carboxyaminoimidazole ribonucleotide mutase Acetobacter aceti 1023 Streptomycin Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin inserted Val2 2026-08-29 01:09:52 0
pCDF-mTET1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_81052 TET1 Mus musculus Streptomycin PMID:26932196 Backbone Marker:Novagen; Backbone Size:3780; Vector Backbone:pCDF-Duet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:11:20 1
pAF-HdrB3
 
Resource Report
Resource Website 		RRID:Addgene_184908 Cas9-sgRNA-homology arms Synthetic Streptomycin PMID:37556825 Please visit https://www.biorxiv.org/content/10.1101/2022.03.14.484339v1 for bioRxiv preprint. Vector Backbone:pJRD215; Vector Types:Bacterial Expression, CRISPR, broad-host-range; Bacterial Resistance:Streptomycin 2026-08-29 01:14:27 0
pREDawn-StrR-MCS
 
Resource Report
Resource Website 		RRID:Addgene_188979 Streptomycin PMID:35998606 Please note that Addgene's NGS found a 65bp insertion in the ori region as compared to the Depositor's sequence. The depositor has confirmed that the plasmid functions as described in the associated publication. Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:14:29 0
pYI048
 
Resource Report
Resource Website 		RRID:Addgene_170844 pGH3.17::SMT2-FLAG Streptomycin PMID:36216814 Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:14:38 0
pYI046
 
Resource Report
Resource Website 		RRID:Addgene_170842 pUBQ10::SMT2-FLAG::tOCS Streptomycin PMID:36216814 Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:14:45 0
pYI047
 
Resource Report
Resource Website 		RRID:Addgene_170843 pFRO6::SMT2-FLAG Streptomycin PMID:36216814 Please note that the Addgene verified sequence differs from the depositor reference sequence linked in the supplemental documents section. These differences did not impact plasmid function. The primers 5' - ATCCAAGCTCAAGCTAAGCTcgatgctctcaaggccaa and 3' -TATCTCATTAAAGCAGGATCCTCACTTGTCATCGTCGTCCTTGTAATCAGAACTCTCCTCCGGT were previously used, although the 5' primer differs slightly from the Addgene verified sequence. Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:14:38 0
pYI012
 
Resource Report
Resource Website 		RRID:Addgene_170841 GH3.17p Streptomycin PMID:36216814 Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:14:38 0
NCH1exp
 
Resource Report
Resource Website 		RRID:Addgene_131017 NCH1 Zea mays (maize) Streptomycin PMID:33679862 Backbone Size:11546; Vector Backbone:pH7WG2; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:13:37 0
pCDFDuet-MKK6-EE
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_82718 MKK6 Homo sapiens Streptomycin PMID:28174228 Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin Ser207 to Glu, Thr211 to Glu 2026-08-29 01:11:43 2
pCDFDuet-MKK6-EE p38alpha
 
Resource Report
Resource Website 		RRID:Addgene_82719 MKK6 Homo sapiens Streptomycin PMID:28174228 Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin Ser207 to Glu, Thr211 to Glu 2026-08-29 01:11:35 0
pCDF-casBCDE(+6)
 
Resource Report
Resource Website 		RRID:Addgene_89728 CRISPR array Other Streptomycin PMID:27738137 Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin Derivative CRISPR array containing a longer version of the wt spacer (+6) extended by 6 nucleotides at the leader-distal end. 2026-08-29 01:12:37 0
pAN-PA3-RFP
 
Resource Report
Resource Website 		RRID:Addgene_62249 mRFP Other Streptomycin PMID:25422271 Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:08:23 0
pSAC16
 
Resource Report
Resource Website 		RRID:Addgene_137965 Zea mays Ferredoxin-NADP reductase Zea mays Streptomycin PMID:32434930 Vector Backbone:p15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin 2026-08-29 12:56:13 0
pSAC17
 
Resource Report
Resource Website 		RRID:Addgene_137966 Zea mays Ferredoxin-NADP reductase Zea mays Streptomycin PMID:32434930 Vector Backbone:p15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin 2026-08-29 12:56:13 0
pCDFDuet-nsp7-nsp8
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_159092 NSP7 SARS-CoV-2 isolate Wuhan-Hu Streptomycin PMID:32783916 Please visit https://doi.org/10.1101/2020.07.08.194084 for bioRxiv preprint. Backbone Size:4000; Vector Backbone:pCDF Duet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-29 12:58:17 1
HE_150
 
Resource Report
Resource Website 		RRID:Addgene_201051 n/a Streptomycin This strain has 1059 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110015 and the accompanying paper for more details. Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-29 01:17:18 0
HE_100
 
Resource Report
Resource Website 		RRID:Addgene_201050 n/a Streptomycin This strain has 797 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110016 and the accompanying paper for more details. Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-29 01:17:15 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The PRECISE-TBI toolbox are a collection tools and resources to increase rigor and reproducibility with Traumatic Brain Injury within the PRE Clinical Interagency reSearch resourcE - Traumatic Brain Injury (PRECISE-TBI). Please learn more about PRECISE-TBI at https://www.precise-tbi.org

Recent News Entries

Contact Us

Department of Neurosciences, School of Medicine

University of California, San Diego





About SciCrunch | Privacy Policy | Terms of Service

SciCrunch