Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Mrtfa
Vector Backbone Description: Vector Backbone:aav-tnt-gfp-v2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33361330
Comments: Please note that the Addgene verified sequence detected a 22bp deletion in the ITR region. This deletion does not affect plasmid function.
Proper citation: RRID:Addgene_165037 Copy
Species: Homo sapiens
Genetic Insert: Pig5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9305847
Proper citation: RRID:Addgene_16499 Copy
Species: Homo sapiens
Genetic Insert: Rheb
Vector Backbone Description: Backbone Marker:Available at Addgene (#19319); Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33157014
Proper citation: RRID:Addgene_165031 Copy
Species: Homo sapiens
Genetic Insert: BACE1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22553349
Proper citation: RRID:Addgene_165032 Copy
Species: Synthetic
Genetic Insert: LaGFP(N)-cpFRB2-T2A-FKBP-LaGFP(C)
Vector Backbone Description: Backbone Size:5646; Vector Backbone:pTriEX; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32277990
Proper citation: RRID:Addgene_165030 Copy
Species: Homo sapiens
Genetic Insert: gRNA against HLA class I
Vector Backbone Description: Backbone Size:9703; Vector Backbone:pX330 (Addgene #42230); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338
Proper citation: RRID:Addgene_164986 Copy
Species: Homo sapiens
Genetic Insert: gRNA against HLA class I
Vector Backbone Description: Backbone Size:9703; Vector Backbone:pX330 (Addgene #42230); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338
Proper citation: RRID:Addgene_164987 Copy
Species: Other
Genetic Insert: gal80Arm1-P-AgTEF1-KlURA3-T-AgTEF1-gal80Arm2
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068
Proper citation: RRID:Addgene_165068 Copy
Species: Homo sapiens
Genetic Insert: APC
Vector Backbone Description: Backbone Marker:Vogelstein lab (Addgene plasmid# 16440); Backbone Size:6600; Vector Backbone:pCMV-Neo-Bam; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9065402
Proper citation: RRID:Addgene_16507 Copy
Species: Other
Genetic Insert: gal80Arm1-P-TPI1-KanMX4-gal80Arm2
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068
Proper citation: RRID:Addgene_165069 Copy
Species: Homo sapiens
Genetic Insert: Pig10
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4500; Vector Backbone:pBK-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9305847
Proper citation: RRID:Addgene_16504 Copy
Species: Other
Genetic Insert: T-RPL3>ERG20>P-GAL1-P-GAL2>Y-FAST>ErB1.2A-AcNES1>T-RPL41B
Vector Backbone Description: Vector Backbone:pRS425; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068
Comments: Please note Addgene NGS result identified several mutations in LEU2- V73A, A82G, L199V, D304N. Depositor confirms this does not affect plasmid function. On the contrary the depositor has found "significant improvement on the productivities in the strain harbouring this plasmid."
Proper citation: RRID:Addgene_165067 Copy
Species: Homo sapiens
Genetic Insert: Pig9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9305847
Proper citation: RRID:Addgene_16503 Copy
Genetic Insert: Mad-binding element from Vg
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9660945
Comments: Four copies of the Mad-binding element from Vg (GCTTGGACTGCCGTCGCGATTC) are cloned into pGL3.
Proper citation: RRID:Addgene_16501 Copy
Genetic Insert: Smad binding element
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9660945
Comments: Two copies of the Smad binding site (taaGTCTAGACggcaGTCTAGACgtac) are cloned into pGL3.
Proper citation: RRID:Addgene_16500 Copy
Species: Other
Genetic Insert: P-URA3>KlURA3>T-AgTEF1- T-PGK1-P-ACS2> SKP1>OsTIR1opt>T-URA3
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068
Proper citation: RRID:Addgene_165061 Copy
Species: Other
Genetic Insert: P-URA3>KlURA3>T-AgTEF1-P-TEF1> (BamHI)yEGFP>T-PGK1-T-URA3
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068
Proper citation: RRID:Addgene_165064 Copy
Species: Other
Genetic Insert: T-RPL3>ERG20-N127W>P-GAL1-P-GAL10>Y-FAST>T-ALD6-P-GAL2>ClLS>T-RPL41B
Vector Backbone Description: Vector Backbone:pRS425; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33594068
Proper citation: RRID:Addgene_165062 Copy
Species: Homo sapiens
Genetic Insert: TRB
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338
Proper citation: RRID:Addgene_165002 Copy
Species: Homo sapiens
Genetic Insert: TRAV
Vector Backbone Description: Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33483338
Proper citation: RRID:Addgene_165001 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.