Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

739,423 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pDEST myc MOV10 D645N
 
Resource Report
Resource Website
RRID:Addgene_51720 MOV10 D645N Homo sapiens Ampicillin PMID:24726324 Backbone Marker:Invitrogen; Backbone Size:5882; Vector Backbone:pDEST26; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin D645N 2026-08-01 01:14:27 0
pcDNA3.1-aDTX-lumitoxin
 
Resource Report
Resource Website
RRID:Addgene_51686 aDTX-lumitoxin Synthetic Ampicillin PMID:24407101 Backbone Size:5341; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:26 0
SpyLigase
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51722 SpyLigase Synthetic Ampicillin PMID:24639550 SnoopLigase is the more recent peptide-peptide ligation technology from the Howarth lab and is now preferred over SpyLigase in terms of more general reaction conditions and higher coupling yield on a range of proteins. pET28a-AviTag-SnoopLigase https://www.addgene.org/105626/ pET28a-HaloTag7-SnoopLigase https://www.addgene.org/105627/ SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Jacob O. Fierer, Gianluca Veggiani and Mark Howarth Transform plasmid into BL21 DE3 RIPL for expression. Backbone Marker:Life Technologies; Backbone Size:6400; Vector Backbone:pDEST14; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 2
p18S.1 G693A
 
Resource Report
Resource Website
RRID:Addgene_51728 18S Mus musculus Ampicillin PMID:22718970 Please note that the depositor sequence is theoretical. Addgene verified that the nucleotides A5152 (nucleotide 963 in 18 S rRNA) and G5162 are expected in 18S, based on the publication and GenBank ID: JQ247698.1. Please see Addgene's result using the m18Sinternal-rev primer in the "Sequences" link above. Backbone Marker:promega; Backbone Size:2000; Vector Backbone:pCMV; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 0
DRH296: FCK-Optopatch2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51694 Optopatch2 Synthetic Ampicillin PMID:24952910 Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 8
DRH335: FCK-Optopatch1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51695 Optopatch1 Synthetic Ampicillin PMID:24952910 Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 2
pCDNA3-ySet2
 
Resource Report
Resource Website
RRID:Addgene_51698 yeast Set2 Saccharomyces cerevisiae Ampicillin PMID:20133523 Backbone Marker:commercial; Backbone Size:5400; Vector Backbone:pcDNA3.1 +; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 0
R5 EMCV
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51733 EMCV IRES Ampicillin PMID:22718970 Backbone Marker:Promega; Backbone Size:4600; Vector Backbone:pGl4.13; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 2
R5 MCS
 
Resource Report
Resource Website
RRID:Addgene_51732 MCS Ampicillin PMID:22718970 Backbone Marker:Promega; Backbone Size:4600; Vector Backbone:pGl4.13; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 0
p413TEF-SirT1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51746 SirT1 Homo sapiens Ampicillin PMID:19390637 Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 2
p413TEF-Sir2
 
Resource Report
Resource Website
RRID:Addgene_51742 Sir2 Saccharomyces cerevisiae Ampicillin PMID:19390637 Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 0
ESAM-bio-His
 
Resource Report
Resource Website
RRID:Addgene_51751 ESAM Homo sapiens Ampicillin PMID:25713122 Article ref 20 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 0
EPHB1-bio-His
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51750 EPHB1 Homo sapiens Ampicillin PMID:25713122 Article ref 19 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 1
ICAM5-bio-His
 
Resource Report
Resource Website
RRID:Addgene_51759 ICAM5 Homo sapiens Ampicillin PMID:25713122 Article ref 28 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 0
ICAM2-bio-His
 
Resource Report
Resource Website
RRID:Addgene_51758 ICAM2 Homo sapiens Ampicillin PMID:25713122 Article ref 27 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 0
FCGR2a-bio-His
 
Resource Report
Resource Website
RRID:Addgene_51754 FCGR2a Homo sapiens Ampicillin PMID:25713122 Article ref 22 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 0
lentiCRISPR - EGFP sgRNA 3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51762 Cas9 Synthetic Ampicillin PMID:24336571 gRNA target sequence GGCCACAAGTTCAGCGTGTC These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information. Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 2
pCDNA3 T7 Jip1(delta JBD)
 
Resource Report
Resource Website
RRID:Addgene_51767 Jnk interacting protein 1 Mus musculus Ampicillin PMID:9235893 Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted 126-263 2026-08-01 01:14:27 0
RP1B-PP1beta
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51769 pp1 beta Kanamycin Backbone Marker:Peti Lab (Addgene Plasmid# 26563); Vector Backbone:RP1B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Contains PP1 beta residues 6-327 2026-08-01 01:14:27 1
lentiCRISPR - EGFP sgRNA 4
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51763 Cas9 Synthetic Ampicillin PMID:24336571 gRNA target sequence GGAGCGCACCATCTTCTTCA These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information. Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-01 01:14:27 4

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.