Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 82 showing 1621 ~ 1640 out of 739,718 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/51720

Species: Homo sapiens
Genetic Insert: MOV10 D645N
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5882; Vector Backbone:pDEST26; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24726324

Proper citation: RRID:Addgene_51720 Copy   


http://www.addgene.org/51686

Species: Synthetic
Genetic Insert: aDTX-lumitoxin
Vector Backbone Description: Backbone Size:5341; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24407101

Proper citation: RRID:Addgene_51686 Copy   


  • RRID:Addgene_51722

    This resource has 1+ mentions.

http://www.addgene.org/51722

Species: Synthetic
Genetic Insert: SpyLigase
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:6400; Vector Backbone:pDEST14; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24639550
Comments: SnoopLigase is the more recent peptide-peptide ligation technology from the Howarth lab and is now preferred over SpyLigase in terms of more general reaction conditions and higher coupling yield on a range of proteins. pET28a-AviTag-SnoopLigase https://www.addgene.org/105626/ pET28a-HaloTag7-SnoopLigase https://www.addgene.org/105627/ SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Jacob O. Fierer, Gianluca Veggiani and Mark Howarth Transform plasmid into BL21 DE3 RIPL for expression.

Proper citation: RRID:Addgene_51722 Copy   


  • RRID:Addgene_51728

http://www.addgene.org/51728

Species: Mus musculus
Genetic Insert: 18S
Vector Backbone Description: Backbone Marker:promega; Backbone Size:2000; Vector Backbone:pCMV; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22718970
Comments: Please note that the depositor sequence is theoretical. Addgene verified that the nucleotides A5152 (nucleotide 963 in 18 S rRNA) and G5162 are expected in 18S, based on the publication and GenBank ID: JQ247698.1. Please see Addgene's result using the m18Sinternal-rev primer in the "Sequences" link above.

Proper citation: RRID:Addgene_51728 Copy   


  • RRID:Addgene_51694

    This resource has 1+ mentions.

http://www.addgene.org/51694

Species: Synthetic
Genetic Insert: Optopatch2
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952910

Proper citation: RRID:Addgene_51694 Copy   


  • RRID:Addgene_51695

    This resource has 1+ mentions.

http://www.addgene.org/51695

Species: Synthetic
Genetic Insert: Optopatch1
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952910

Proper citation: RRID:Addgene_51695 Copy   


  • RRID:Addgene_51698

http://www.addgene.org/51698

Species: Saccharomyces cerevisiae
Genetic Insert: yeast Set2
Vector Backbone Description: Backbone Marker:commercial; Backbone Size:5400; Vector Backbone:pcDNA3.1 +; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20133523

Proper citation: RRID:Addgene_51698 Copy   


  • RRID:Addgene_51733

    This resource has 1+ mentions.

http://www.addgene.org/51733

Genetic Insert: EMCV IRES
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4600; Vector Backbone:pGl4.13; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22718970

Proper citation: RRID:Addgene_51733 Copy   


  • RRID:Addgene_51732

http://www.addgene.org/51732

Genetic Insert: MCS
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4600; Vector Backbone:pGl4.13; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22718970

Proper citation: RRID:Addgene_51732 Copy   


  • RRID:Addgene_51746

    This resource has 1+ mentions.

http://www.addgene.org/51746

Species: Homo sapiens
Genetic Insert: SirT1
Vector Backbone Description: Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19390637

Proper citation: RRID:Addgene_51746 Copy   


  • RRID:Addgene_51742

http://www.addgene.org/51742

Species: Saccharomyces cerevisiae
Genetic Insert: Sir2
Vector Backbone Description: Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19390637

Proper citation: RRID:Addgene_51742 Copy   


  • RRID:Addgene_51751

http://www.addgene.org/51751

Species: Homo sapiens
Genetic Insert: ESAM
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 20

Proper citation: RRID:Addgene_51751 Copy   


  • RRID:Addgene_51750

    This resource has 1+ mentions.

http://www.addgene.org/51750

Species: Homo sapiens
Genetic Insert: EPHB1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 19

Proper citation: RRID:Addgene_51750 Copy   


  • RRID:Addgene_51759

http://www.addgene.org/51759

Species: Homo sapiens
Genetic Insert: ICAM5
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 28

Proper citation: RRID:Addgene_51759 Copy   


  • RRID:Addgene_51758

http://www.addgene.org/51758

Species: Homo sapiens
Genetic Insert: ICAM2
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 27

Proper citation: RRID:Addgene_51758 Copy   


  • RRID:Addgene_51754

http://www.addgene.org/51754

Species: Homo sapiens
Genetic Insert: FCGR2a
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 22

Proper citation: RRID:Addgene_51754 Copy   


  • RRID:Addgene_51762

    This resource has 1+ mentions.

http://www.addgene.org/51762

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGCCACAAGTTCAGCGTGTC These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.

Proper citation: RRID:Addgene_51762 Copy   


http://www.addgene.org/51767

Species: Mus musculus
Genetic Insert: Jnk interacting protein 1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9235893

Proper citation: RRID:Addgene_51767 Copy   


  • RRID:Addgene_51769

    This resource has 1+ mentions.

http://www.addgene.org/51769

Genetic Insert: pp1 beta
Vector Backbone Description: Backbone Marker:Peti Lab (Addgene Plasmid# 26563); Vector Backbone:RP1B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_51769 Copy   


  • RRID:Addgene_51763

    This resource has 1+ mentions.

http://www.addgene.org/51763

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGAGCGCACCATCTTCTTCA These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.

Proper citation: RRID:Addgene_51763 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X