Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 8 showing 141 ~ 160 out of 228 results
Snippet view Table view Download 228 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_184908

http://www.addgene.org/184908

Species: Synthetic
Genetic Insert: Cas9-sgRNA-homology arms
Vector Backbone Description: Vector Backbone:pJRD215; Vector Types:Bacterial Expression, CRISPR, broad-host-range; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37556825
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.14.484339v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_184908 Copy   


  • RRID:Addgene_188979

http://www.addgene.org/188979

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:35998606
Comments: Please note that Addgene's NGS found a 65bp insertion in the ori region as compared to the Depositor's sequence. The depositor has confirmed that the plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_188979 Copy   


  • RRID:Addgene_131017

http://www.addgene.org/131017

Species: Zea mays (maize)
Genetic Insert: NCH1
Vector Backbone Description: Backbone Size:11546; Vector Backbone:pH7WG2; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33679862

Proper citation: RRID:Addgene_131017 Copy   


  • RRID:Addgene_170844

http://www.addgene.org/170844

Genetic Insert: pGH3.17::SMT2-FLAG
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.

Proper citation: RRID:Addgene_170844 Copy   


  • RRID:Addgene_170842

http://www.addgene.org/170842

Genetic Insert: pUBQ10::SMT2-FLAG::tOCS
Vector Backbone Description: Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.

Proper citation: RRID:Addgene_170842 Copy   


  • RRID:Addgene_170843

http://www.addgene.org/170843

Genetic Insert: pFRO6::SMT2-FLAG
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please note that the Addgene verified sequence differs from the depositor reference sequence linked in the supplemental documents section. These differences did not impact plasmid function. The primers 5' - ATCCAAGCTCAAGCTAAGCTcgatgctctcaaggccaa and 3' -TATCTCATTAAAGCAGGATCCTCACTTGTCATCGTCGTCCTTGTAATCAGAACTCTCCTCCGGT were previously used, although the 5' primer differs slightly from the Addgene verified sequence. Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.

Proper citation: RRID:Addgene_170843 Copy   


  • RRID:Addgene_170841

http://www.addgene.org/170841

Genetic Insert: GH3.17p
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.

Proper citation: RRID:Addgene_170841 Copy   


  • RRID:Addgene_189857

    This resource has 1+ mentions.

http://www.addgene.org/189857

Species: Synthetic
Genetic Insert: ΔrecA
Vector Backbone Description: Vector Backbone:N.A.; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36922599
Comments: Details of construction, use, and characterization are available in Nyerges A, Vinke S, Flynn R, Owen SV, Rand EA, Budnik B, Keen E, Narasimhan K, Marchand JA, Baas-Thomas M, Liu M, Chen K, Chiappino-Pepe A, Hu F, Baym M, Church GM (2022) Swapped genetic code blocks viral infections and gene transfer, https://doi.org/10.1101/2022.07.08.499367 https://www.biorxiv.org/content/10.1101/2022.07.08.499367v1.full

Proper citation: RRID:Addgene_189857 Copy   


  • RRID:Addgene_201051

http://www.addgene.org/201051

Genetic Insert: n/a
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Comments: This strain has 1059 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110015 and the accompanying paper for more details.

Proper citation: RRID:Addgene_201051 Copy   


  • RRID:Addgene_201050

http://www.addgene.org/201050

Genetic Insert: n/a
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Comments: This strain has 797 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110016 and the accompanying paper for more details.

Proper citation: RRID:Addgene_201050 Copy   


  • RRID:Addgene_114362

http://www.addgene.org/114362

Species: Synthetic
Genetic Insert: 24X601-MA1_2
Vector Backbone Description: Vector Backbone:pENTR223; Vector Types:Mammalian Expression, Unspecified; Bacterial Resistance:Streptomycin
Defining Citation: PMID:30455303

Proper citation: RRID:Addgene_114362 Copy   


  • RRID:Addgene_114361

http://www.addgene.org/114361

Species: Synthetic
Genetic Insert: 24X601-MA1_2
Vector Backbone Description: Vector Backbone:pBS; Vector Types:Mammalian Expression, Unspecified; Bacterial Resistance:Streptomycin
Defining Citation: PMID:30455303

Proper citation: RRID:Addgene_114361 Copy   


  • RRID:Addgene_114359

http://www.addgene.org/114359

Species: Synthetic
Genetic Insert: 12X601-MA2
Vector Backbone Description: Vector Backbone:pBS; Vector Types:Mammalian Expression, Unspecified; Bacterial Resistance:Streptomycin
Defining Citation: PMID:30455303

Proper citation: RRID:Addgene_114359 Copy   


  • RRID:Addgene_213154

http://www.addgene.org/213154

Species: Xenorhabdus bovienii SS-2004
Genetic Insert: Leupeptin Protease Inhibitor Pathway
Vector Backbone Description: Backbone Marker:Novagen (EMD Millipore); Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34581573

Proper citation: RRID:Addgene_213154 Copy   


  • RRID:Addgene_225175

http://www.addgene.org/225175

Vector Backbone Description: Backbone Size:5004; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39244484
Comments: Low copy plasmid (pSC101 ori and repA), pUC18 MCS, confers streptomycin resistance

Proper citation: RRID:Addgene_225175 Copy   


  • RRID:Addgene_225180

http://www.addgene.org/225180

Vector Backbone Description: Backbone Size:5007; Vector Backbone:pHBJT023; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39244484
Comments: pHBJT023 containing IPTG-inducible mCherry

Proper citation: RRID:Addgene_225180 Copy   


  • RRID:Addgene_220231

http://www.addgene.org/220231

Species: Homo sapiens
Genetic Insert: Human liver pyruvate kinase
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4290; Vector Backbone:pCDF-Duet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37171062
Comments: Expression and purification of an exogenous PYK requires the E. coli strain QTF60, a BL21-derivative lacking both endogenous PYK genes (pykF and pykA).

Proper citation: RRID:Addgene_220231 Copy   


  • RRID:Addgene_213133

http://www.addgene.org/213133

Vector Backbone Description: Backbone Size:5267; Vector Backbone:CloDF13; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39126322

Proper citation: RRID:Addgene_213133 Copy   


  • RRID:Addgene_213134

http://www.addgene.org/213134

Vector Backbone Description: Backbone Size:6291; Vector Backbone:CloDF13; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39126322

Proper citation: RRID:Addgene_213134 Copy   


  • RRID:Addgene_207530

    This resource has 1+ mentions.

http://www.addgene.org/207530

Genetic Insert: cytidine base editing; oriV(pRO1600/ColE1), xylS, Pm→repA, P14b→msfGFP; Pm→CBE:SpRY, PEM7→non-specific sgRNA
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826

Proper citation: RRID:Addgene_207530 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X