Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ALIX
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21502 Copy
Species: Caenorhabditis elegans
Genetic Insert: (Gly)5Ala::GFP(w introns)::tbb-2 3'UTR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2639; Vector Backbone:pDONR P2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_21509 Copy
Species: Homo sapiens
Genetic Insert: mitogen-activated protein kinase kinase kinase 3
Vector Backbone Description: Backbone Marker:Unknown; Backbone Size:5100; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: lysine mutant activity unknown
Proper citation: RRID:Addgene_21585 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: M2-FLAG,
Lysine mutant, inactive
Proper citation: RRID:Addgene_21583 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: M2-FLAG
Proper citation: RRID:Addgene_21582 Copy
Species: Homo sapiens
Genetic Insert: CEP55-EABR (ESCRT and ALIX Binding Region) domain
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: PNC to MGS mut in beginning of protein; author says that this is the plasmid that was used in publication.
Proper citation: RRID:Addgene_21501 Copy
Species: Mus musculus
Genetic Insert: GFP-ING2(pHD)
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_21589 Copy
Species: Rattus norvegicus
Genetic Insert: Dazl shRNA-1
Vector Backbone Description: Backbone Size:8264; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Dazl shRNA sequence is - 5'-TTTGGGCTATGGATTTGTCTCATTCAAGAGATGAGACAAATCCATAGCCCTTTT
Proper citation: RRID:Addgene_21621 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Luk van Parijs; Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: hUbC promoter was inserted upstream of EGFP.
There are minor sequence discrepancies with depositor's sequence. Depositor is aware of the mismatches and they are acceptable.
Proper citation: RRID:Addgene_21620 Copy
Species: Homo sapiens
Genetic Insert: TNF receptor-associated factor 2
Vector Backbone Description: Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21586 Copy
Species: Homo sapiens
Genetic Insert: Lin28B
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: N-terminal deletion (70 amino acids)
Proper citation: RRID:Addgene_51374 Copy
Species: Homo sapiens
Genetic Insert: pri-let-7a-1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_51377 Copy
Species: Mus musculus
Genetic Insert: dynein intermediate chain IC2C
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_51410 Copy
Species: Homo sapiens
Genetic Insert: pri-miR-29b-1~29a
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Point mutations: insertion (1115bp), deletion (A47, T666) (Unnecessary region for miRNA biogenesis)
Proper citation: RRID:Addgene_51376 Copy
Species: Homo sapiens
Genetic Insert: Lin28B
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_51373 Copy
Species: Homo sapiens
Genetic Insert: Lin28A
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: H147A, H169A
Proper citation: RRID:Addgene_51372 Copy
Species: Gallus gallus
Genetic Insert: DCTN1
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pGW1-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_51412 Copy
Species: Homo sapiens
Genetic Insert: pri-let-7b
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_51378 Copy
Species: Homo sapiens
Genetic Insert: Kinesin-associated protein 3
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_51413 Copy
Species: Gallus gallus
Genetic Insert: Dynamitin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6300; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_51419 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
