Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Hoxb7 promoter
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS+; Vector Types:Promoter can be used to make transgenic mice; Bacterial Resistance:Ampicillin
References:
Comments: Hoxb7 promoter #25, DNA #M126. The Hoxb7promoter fragment (sequences from −1316 to +81 of the Hoxb7gene), obtained from Dr Jacqueline Deschamps, was excised from the pGEM-Blue vector with KpnI and AvaI,
the ends blunted, and recloned into the EcoRV site of pBluescript KS+ in both orientations.
Proper citation: RRID:Addgene_21294 Copy
Species: Mus musculus
Genetic Insert: rictor shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: mouse rictor shRNA 1
shRNA oligo sequence is 5'- CCGGGCCAGTAAGATGGGAATCATTCTCGAGAATGATTCCCATCTTACTGGCTTTTTG -3'
Proper citation: RRID:Addgene_21341 Copy
Species: Mus musculus
Genetic Insert: raptor shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: mouse raptor shRNA 2
shRNA oligo sequence is 5'- CCGGGCCCGAGTCTGTGAATGTAATCTCGAGATTACATTCACAGACTCGGGCTTTTTG -3'
Proper citation: RRID:Addgene_21340 Copy
Species: Mus musculus
Genetic Insert: Notch4
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pHyTc; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21468 Copy
Species: Homo sapiens
Genetic Insert: kelch-like ECH-associated protein 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5407; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21552 Copy
Species:
Genetic Insert: UAS-hsp70 luciferase
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3415; Vector Backbone:pBluescript SK(-); Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_21604 Copy
Species: Homo sapiens
Genetic Insert: MCL-1 S159A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5523; Vector Backbone:pcDNA3.1 /V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21606 Copy
Species: Mus musculus
Genetic Insert: mitogen-activated protein kinase kinase 4
Vector Backbone Description: Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: missing first 10 amino acids
Proper citation: RRID:Addgene_21563 Copy
Species:
Genetic Insert: No insert
Vector Backbone Description: Backbone Size:6909; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Chloramphenicol and Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_21562 Copy
Species:
Genetic Insert: Firefly luciferase shRNA
Vector Backbone Description: Backbone Size:5596; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_21561 Copy
Species: Homo sapiens
Genetic Insert: Ago4
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCl-neo_NHA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21537 Copy
Species: Homo sapiens
Genetic Insert: Ago4
Vector Backbone Description: Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21536 Copy
Species: Homo sapiens
Genetic Insert: Ago1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCl-neo_NHA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21535 Copy
Species: Homo sapiens
Genetic Insert: 1.5kb 5' of miR-145
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pTransluc (Panomics); Vector Types:Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Plasmid 21496: P-miR-145 (pTransluc-miR-145-1) has a mutation in the miR-145 sequence resulting in A to G mutation. The mutation is a SNP from the human ES cells H9.
Proper citation: RRID:Addgene_21496 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VPS4
Vector Backbone Description: Backbone Size:5037; Vector Backbone:parallel GST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21495 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SNF7
Vector Backbone Description: Backbone Size:5549; Vector Backbone:pHis2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21492 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VPS20
Vector Backbone Description: Backbone Size:5549; Vector Backbone:pHis2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21490 Copy
Species: Homo sapiens
Genetic Insert: nuclear factor (erythroid-derived 2)-like 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6112; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21549 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:3000; Vector Backbone:Bluescript; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21548 Copy
Species: MuHV-4
Genetic Insert: ORF73
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMVmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Myc tag is missing a Glutamic acid in the beginning.
Proper citation: RRID:Addgene_21545 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.