Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 70 showing 1381 ~ 1400 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_21260

    This resource has 1+ mentions.

http://www.addgene.org/21260

Species: Mus musculus
Genetic Insert: Krox20 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19179536
Comments: There is a T to C mismatch with Krox20. The single mis-match of the nucleotide is likely to reflect the polymorphism of different mouse strain used in the cloning.

Proper citation: RRID:Addgene_21260 Copy   


  • RRID:Addgene_21381

http://www.addgene.org/21381

Species: Caenorhabditis elegans
Genetic Insert: lip-1 M1M2 3'utr in pDONRP2RP3
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pDONRP2RP3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18818082

Proper citation: RRID:Addgene_21381 Copy   


http://www.addgene.org/21474

Species: Firefly
Genetic Insert: V5-LUC
Vector Backbone Description: Backbone Size:7687; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_21474 Copy   


http://www.addgene.org/21472

Genetic Insert: Firefly luciferase shRNA
Vector Backbone Description: Backbone Size:7757; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_21472 Copy   


http://www.addgene.org/21471

Species: Firefly
Genetic Insert: V5-LUC
Vector Backbone Description: Backbone Size:7334; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_21471 Copy   


  • RRID:Addgene_21470

http://www.addgene.org/21470

Species: Mus musculus
Genetic Insert: Notch4
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBSKS; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9576833

Proper citation: RRID:Addgene_21470 Copy   


  • RRID:Addgene_21404

    This resource has 1+ mentions.

http://www.addgene.org/21404

Species: Homo sapiens
Genetic Insert: EGLN1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15563275

Proper citation: RRID:Addgene_21404 Copy   


  • RRID:Addgene_21403

    This resource has 1+ mentions.

http://www.addgene.org/21403

Species: Homo sapiens
Genetic Insert: HIF1AN
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12615973

Proper citation: RRID:Addgene_21403 Copy   


  • RRID:Addgene_21368

    This resource has 1+ mentions.

http://www.addgene.org/21368

Species: Homo sapiens
Genetic Insert: autosomal dominant polycystic kidney disease type I
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8500; Vector Backbone:pREP10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482949
Comments: Please note that Addgene NGS observed a S999P mutation in the PKD1 ORF. The effect of this mutation in unknown.

Proper citation: RRID:Addgene_21368 Copy   


  • RRID:Addgene_21367

    This resource has 1+ mentions.

http://www.addgene.org/21367

Species: Homo sapiens
Genetic Insert: autosomal dominant polycystic kidney disease type I
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482949
Comments: *Please note: during Addgene's quality control process, the following mutations were found in PKD1: A691P, M792L, S999P, N1056T, T1724A, M1976V. The depositor has noted that the plasmid appears to be functional using several assays but it is not the standard PKD1 sequence in the database (Genbank ID L33243).

Proper citation: RRID:Addgene_21367 Copy   


  • RRID:Addgene_21366

http://www.addgene.org/21366

Species: Homo sapiens
Genetic Insert: autosomal dominant polycystic kidney disease type I
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482949

Proper citation: RRID:Addgene_21366 Copy   


  • RRID:Addgene_21338

    This resource has 1+ mentions.

http://www.addgene.org/21338

Species: Mus musculus
Genetic Insert: DEPTOR shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse DEPTOR shRNA 2 TRCN0000110159; NM_145470.1-1165s1c1 shRNA oligo sequence is - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG

Proper citation: RRID:Addgene_21338 Copy   


  • RRID:Addgene_21337

    This resource has 1+ mentions.

http://www.addgene.org/21337

Species: Mus musculus
Genetic Insert: DEPTOR shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse DEPTOR shRNA 1 TRCN0000110157; NM_145470.1-1164s1c1 shRNA oligo sequence is - 5'-CCGGCGCAAGGAAGACATTCACGATCTCGAGATCG TGAATGTCTTCCTTGCGTTTTTG

Proper citation: RRID:Addgene_21337 Copy   


  • RRID:Addgene_21299

    This resource has 1+ mentions.

http://www.addgene.org/21299

Genetic Insert: I-SceI
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pLew100; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19369939
Comments: There are a few discrepancies between Addgene's sequence and the provided sequence from the depositing lab. These discrepancies do not affect plasmid function.

Proper citation: RRID:Addgene_21299 Copy   


  • RRID:Addgene_21298

    This resource has 1+ mentions.

http://www.addgene.org/21298

Species: Homo sapiens
Genetic Insert: shMTH1-2
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19118192
Comments: shRNA #2 directed against MTH1 sequence 5-GAAATTCCACGGGTACTTCAA-3′.

Proper citation: RRID:Addgene_21298 Copy   


  • RRID:Addgene_21297

    This resource has 1+ mentions.

http://www.addgene.org/21297

Species: Homo sapiens
Genetic Insert: shMTH1-1
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19118192
Comments: shRNA #1 directed against MTH1 sequence 5′-GTGGCTGCTGAACAGCTGCAA-3′.

Proper citation: RRID:Addgene_21297 Copy   


  • RRID:Addgene_21330

http://www.addgene.org/21330

Species: Mus musculus
Genetic Insert: Int3
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pLHTC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9576833

Proper citation: RRID:Addgene_21330 Copy   


http://www.addgene.org/21336

Species: Homo sapiens
Genetic Insert: DEPTOR shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: human DEPTOR shRNA 2 TRC candidate; NM_022783.1-1101s1c1 shRNA oligo sequence - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG

Proper citation: RRID:Addgene_21336 Copy   


  • RRID:Addgene_21335

    This resource has 1+ mentions.

http://www.addgene.org/21335

Species: Homo sapiens
Genetic Insert: DEPTOR shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene (#10878); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: human DEPTOR shRNA 1 TRC candidate; NM_022783.1-877s1c1 shRNA oligo sequence - 5'-CCGGGCCATGACAATCGGAAATCTACTCGAGTAGATTTCCGATTGTCATGGCTTTTTG

Proper citation: RRID:Addgene_21335 Copy   


  • RRID:Addgene_21295

    This resource has 1+ mentions.

http://www.addgene.org/21295

Species: Homo sapiens
Genetic Insert: MTH1
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19118192
Comments: The pBabe.puro MTH1 overexpression construct was created by amplifying the MTH1 cDNA from pcDEB.MTH1 (which expresses full-length wild type human MTH1) using PCR primers to add BamHI and EcoRI cloning sites to the 5' and 3' ends respectively, and ligating the resulting fragment into the appropriately digested retroviral pBABE puro vector.

Proper citation: RRID:Addgene_21295 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X