Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,423 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
Krox20 promoter pGL3-TATA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21260 Krox20 promoter Mus musculus Ampicillin PMID:19179536 There is a T to C mismatch with Krox20. The single mis-match of the nucleotide is likely to reflect the polymorphism of different mouse strain used in the cloning. Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-01 01:10:04 2
pCM1.95
 
Resource Report
Resource Website 		RRID:Addgene_21381 lip-1 M1M2 3'utr in pDONRP2RP3 Caenorhabditis elegans Kanamycin PMID:18818082 Backbone Size:2641; Vector Backbone:pDONRP2RP3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-01 01:10:05 0
pLenti CMV V5-LUC Blast (w567-1)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_21474 V5-LUC Firefly Ampicillin PMID:19657394 Backbone Size:7687; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 29
pLenti X2 Puro/pTER shLUC (w589-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21472 Firefly luciferase shRNA Ampicillin PMID:19657394 Backbone Size:7757; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 1
pLenti PGK V5-LUC Neo (w623-2)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_21471 V5-LUC Firefly Ampicillin PMID:19657394 Backbone Size:7334; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin 2026-08-01 01:10:17 37
pBS Notch4HA
 
Resource Report
Resource Website 		RRID:Addgene_21470 Notch4 Mus musculus Ampicillin PMID:9576833 Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBSKS; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 0
pGL3b(1454/3172)P2P-wt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21404 EGLN1 Homo sapiens Ampicillin PMID:15563275 Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 1
pEGFP-N1-FIH1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21403 HIF1AN Homo sapiens Kanamycin PMID:12615973 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-01 01:10:17 2
WT (REP10)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21368 autosomal dominant polycystic kidney disease type I Homo sapiens Ampicillin PMID:12482949 Please note that Addgene NGS observed a S999P mutation in the PKD1 ORF. The effect of this mutation in unknown. Backbone Marker:Invitrogen; Backbone Size:8500; Vector Backbone:pREP10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 1
GFP-WT (AF41)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21367 autosomal dominant polycystic kidney disease type I Homo sapiens Ampicillin PMID:12482949 *Please note: during Addgene's quality control process, the following mutations were found in PKD1: A691P, M792L, S999P, N1056T, T1724A, M1976V. The depositor has noted that the plasmid appears to be functional using several assays but it is not the standard PKD1 sequence in the database (Genbank ID L33243). Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wild-type sequence* 2026-08-01 01:10:16 1
E3020X
 
Resource Report
Resource Website 		RRID:Addgene_21366 autosomal dominant polycystic kidney disease type I Homo sapiens Ampicillin PMID:12482949 Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed E3020 to stop codon 2026-08-01 01:10:05 0
pLKO mouse shRNA 2 DEPTOR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21338 DEPTOR shRNA 2 Mus musculus Ampicillin PMID:19446321 mouse DEPTOR shRNA 2 TRCN0000110159; NM_145470.1-1165s1c1 shRNA oligo sequence is - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 2
pLKO mouse shRNA 1 DEPTOR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21337 DEPTOR shRNA 1 Mus musculus Ampicillin PMID:19446321 mouse DEPTOR shRNA 1 TRCN0000110157; NM_145470.1-1164s1c1 shRNA oligo sequence is - 5'-CCGGCGCAAGGAAGACATTCACGATCTCGAGATCG TGAATGTCTTCCTTGCGTTTTTG Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 3
pLew100::NLS-ISceI-HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21299 I-SceI Ampicillin PMID:19369939 There are a few discrepancies between Addgene's sequence and the provided sequence from the depositing lab. These discrepancies do not affect plasmid function. Backbone Size:4300; Vector Backbone:pLew100; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:10:04 1
pLKO.1 shMTH1-2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21298 shMTH1-2 Homo sapiens Ampicillin PMID:19118192 shRNA #2 directed against MTH1 sequence 5-GAAATTCCACGGGTACTTCAA-3′. Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:16 2
pLKO.1 shMTH1-1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21297 shMTH1-1 Homo sapiens Ampicillin PMID:19118192 shRNA #1 directed against MTH1 sequence 5′-GTGGCTGCTGAACAGCTGCAA-3′. Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:04 2
pLHTC Int3HA
 
Resource Report
Resource Website 		RRID:Addgene_21330 Int3 Mus musculus Ampicillin PMID:9576833 Backbone Size:6700; Vector Backbone:pLHTC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-01 01:10:16 0
pLKO human shRNA 2 DEPTOR
 
Resource Report
Resource Website 		RRID:Addgene_21336 DEPTOR shRNA 2 Homo sapiens Ampicillin PMID:19446321 human DEPTOR shRNA 2 TRC candidate; NM_022783.1-1101s1c1 shRNA oligo sequence - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:16 0
pLKO human shRNA 1 DEPTOR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21335 DEPTOR shRNA 1 Homo sapiens Ampicillin PMID:19446321 human DEPTOR shRNA 1 TRC candidate; NM_022783.1-877s1c1 shRNA oligo sequence - 5'-CCGGGCCATGACAATCGGAAATCTACTCGAGTAGATTTCCGATTGTCATGGCTTTTTG Backbone Marker:Available from Addgene (#10878); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:05 1
pBabe puro MTH1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21295 MTH1 Homo sapiens Ampicillin PMID:19118192 The pBabe.puro MTH1 overexpression construct was created by amplifying the MTH1 cDNA from pcDEB.MTH1 (which expresses full-length wild type human MTH1) using PCR primers to add BamHI and EcoRI cloning sites to the 5' and 3' ends respectively, and ligating the resulting fragment into the appropriately digested retroviral pBABE puro vector. Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-01 01:10:16 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The PRECISE-TBI toolbox are a collection tools and resources to increase rigor and reproducibility with Traumatic Brain Injury within the PRE Clinical Interagency reSearch resourcE - Traumatic Brain Injury (PRECISE-TBI). Please learn more about PRECISE-TBI at https://www.precise-tbi.org

Recent News Entries

Contact Us

Department of Neurosciences, School of Medicine

University of California, San Diego





About SciCrunch | Privacy Policy | Terms of Service

SciCrunch