Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pUC19-C4ZA16 Resource Report Resource Website |
RRID:Addgene_103090 | C4ZA16(Cas9 coding gene from Eubacterium rectale (strain ATCC 33656 / VPI 0990)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:53 | 0 | |
|
pUC19-B8I085 Resource Report Resource Website |
RRID:Addgene_103089 | B8I085(Cas9 coding gene from Clostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:53 | 0 | |
|
pUC19-Q1QGC9 Resource Report Resource Website |
RRID:Addgene_103121 | • Q1QGC9(Cas9 coding gene from Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:54 | 0 | |
|
pUC19-Q03JI6 Resource Report Resource Website |
RRID:Addgene_103123 | Q03JI6 (Cas9 coding gene from Campylobacter jejuni) | Campylobacter jejuni subsp. jejuni serotype O:2 (strain NCTC 11168) | Ampicillin | PMID:29529247 | Backbone Marker:NEB (New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:54 | 0 | |
|
pUC19-B1UZL4 Resource Report Resource Website |
RRID:Addgene_103085 | B1UZL4(Cas9 coding gene from Clostridium perfringens D str. JGS1721) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:53 | 0 | |
|
pUC19-B5JU35 Resource Report Resource Website |
RRID:Addgene_103087 | B5JU35(Cas9 coding gene from gamma proteobacterium HTCC5015) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:53 | 0 | |
|
pUC19-Q8DTE3 Resource Report Resource Website |
RRID:Addgene_103129 | Q8DTE3(Cas9 coding gene from Treponema denticola (strain ATCC 35405 / CIP 103919 / DSM 14222)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:54 | 0 | |
|
pUC19-Q5L8F8 Resource Report Resource Website |
RRID:Addgene_103126 | Q5L8F8(Cas9 coding gene from Bacteroides fragilis (strain ATCC 25285 / NCTC 9343)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:54 | 0 | |
|
pUC19-Q6KIQ7 Resource Report Resource Website |
RRID:Addgene_103128 | Q6KIQ7(Cas9 coding gene from Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:54 | 0 | |
|
pUC19-Q5X8T6 Resource Report Resource Website |
RRID:Addgene_103127 | Q5X8T6(Cas9 coding gene from Legionella pneumophila (strain Paris)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:54 | 0 | |
|
LSB-hsa-miR-1185-1-3p Resource Report Resource Website |
RRID:Addgene_103180 | hsa-miR-1185-1-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:33:54 | 0 | |
|
LSB-hsa-miR-1185-2-3p Resource Report Resource Website |
RRID:Addgene_103181 | hsa-miR-1185-2-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:33:54 | 0 | |
|
LSB-hsa-miR-10a-3p Resource Report Resource Website |
RRID:Addgene_103176 | hsa-miR-10a-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:33:54 | 0 | |
|
LSB-hsa-miR-10b-5p Resource Report Resource Website |
RRID:Addgene_103179 | hsa-miR-10b-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:33:54 | 0 | |
|
LSB-hsa-miR-10b-3p Resource Report Resource Website |
RRID:Addgene_103178 | hsa-miR-10b-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:33:54 | 0 | |
|
LSB-hsa-miR-107 Resource Report Resource Website |
RRID:Addgene_103175 | hsa-miR-107 target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:33:54 | 0 | |
|
LSB-hsa-miR-125b-5p Resource Report Resource Website |
RRID:Addgene_103191 | hsa-miR-125b-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:33:54 | 0 | |
|
LSB-hsa-miR-126-3p Resource Report Resource Website 1+ mentions |
RRID:Addgene_103192 | hsa-miR-126-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:33:54 | 1 | |
|
pUC19-E3HCA8 Resource Report Resource Website |
RRID:Addgene_103100 | E3HCA8(Cas9 coding gene from Ilyobacter polytropus (strain DSM 2926 / CuHBu1)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-07-25 12:33:53 | 0 | |
|
LSB-hsa-miR-125a-3p Resource Report Resource Website |
RRID:Addgene_103187 | hsa-miR-125a-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:33:54 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
