Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

743,607 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
BRAF in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216605 BRAF Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin Addgene 2026-10-10 02:06:55 0
pGAL4-DBD-EGR1-AroPATCHY3
 
Resource Report
Resource Website 		RRID:Addgene_215595 EGR1 AroPATCHY3 Homo sapiens Ampicillin PMID:38969762 Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:55 0
pCMV_nLightG
 
Resource Report
Resource Website 		RRID:Addgene_217656 nLightG Synthetic Kanamycin PMID:37474807 Backbone Size:3974; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:06:56 0
TFORF2700
 
Resource Report
Resource Website 		RRID:Addgene_142978 ESRRG Homo sapiens Ampicillin PMID:36608654 NM_001438,ENST00000408911 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:55 0
pzk491-pmax-NES-PUFc-FseI[ADAR2-DD-splitC]
 
Resource Report
Resource Website 		RRID:Addgene_196842 NES-PUFc-FseI[ADAR2-DD-splitC] Kanamycin PMID:37395412 Please visit https://www.biorxiv.org/content/10.1101/2022.06.21.497089v1 for bioRxiv preprint. Backbone Size:2955; Vector Backbone:pAC90-pmaxGW; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:06:56 0
SHLD3 KO sgRNA #2
 
Resource Report
Resource Website 		RRID:Addgene_207106 CTGAAGGAACAGACTAATTC Homo sapiens Ampicillin PMID:37341699 Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:55 0
BRAF - W531C in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216613 BRAF Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin W531C Addgene 2026-10-10 02:06:55 0
BRAF - G518C in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216612 BRAF Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin G518C Addgene 2026-10-10 02:06:55 0
pCYP58
 
Resource Report
Resource Website 		RRID:Addgene_212891 cytochrome P450 Streptomyces griseolus Kanamycin Vector Backbone:pCYP; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:06:55 0
CTNNB1 - R376H in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216619 CTNNB1 Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin R376H Addgene 2026-10-10 02:06:55 0
pzk488-pmax-NES-PUFc-FseI[ADAR2-DD-splitN]
 
Resource Report
Resource Website 		RRID:Addgene_196841 NES-PUFc-FseI[ADAR2-DD-splitN] Kanamycin PMID:37395412 Please visit https://www.biorxiv.org/content/10.1101/2022.06.21.497089v1 for bioRxiv preprint. Backbone Size:2955; Vector Backbone:pAC90-pmaxGW; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:06:56 0
TFORF2387
 
Resource Report
Resource Website 		RRID:Addgene_144019 MBD2 Homo sapiens Ampicillin PMID:36608654 NM_003927,ENST00000256429 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:55 0
CTNNB1 - G752A in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216623 CTNNB1 Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin G752A Addgene 2026-10-10 02:06:55 0
TFORF1696
 
Resource Report
Resource Website 		RRID:Addgene_143968 SOX21 Homo sapiens Ampicillin PMID:36608654 NM_007084,ENST00000376945 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:55 0
CTNNB1 - T551M in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216621 CTNNB1 Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin T551M Addgene 2026-10-10 02:06:55 0
TFORF1674
 
Resource Report
Resource Website 		RRID:Addgene_142369 RUNX1T1 Homo sapiens Ampicillin PMID:36608654 NM_001198679,ENST00000436581 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:55 0
pzk228-pmax-SgrAI[3xFLAG]-AscI-dPspCas13b(AAAA)
 
Resource Report
Resource Website 		RRID:Addgene_196827 dpspCas13b(AAAA) Kanamycin PMID:37395412 Please visit https://www.biorxiv.org/content/10.1101/2022.06.21.497089v1 for bioRxiv preprint. Backbone Size:2955; Vector Backbone:pAC90-pmaxGW; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K367A, D369A and K370A Addgene 2026-10-10 02:06:56 0
Salsa-BC157-P2F1
 
Resource Report
Resource Website 		RRID:Addgene_202998 EGFP/BC157 Synthetic Ampicillin PMID:37321219 Vector Backbone:pCER206; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:55 0
pSV013
 
Resource Report
Resource Website 		RRID:Addgene_214739 BBa_J23108-RBS(7504)-thyA-RBS(4427)-infA other Spectinomycin PMID:38086386 Vector Backbone:p15A ; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin Addgene 2026-10-10 02:06:55 0
pmax-3xFLAG_3xNLS_dPspCas13b(AAAA)_2xNLS-Clover
 
Resource Report
Resource Website 		RRID:Addgene_196829 dpspCas13b(AAAA) Kanamycin PMID:37395412 Please visit https://www.biorxiv.org/content/10.1101/2022.06.21.497089v1 for bioRxiv preprint. Backbone Size:2955; Vector Backbone:pAC90-pmaxGW; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K367A, D369A and K370A Addgene 2026-10-10 02:06:56 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The PRECISE-TBI toolbox are a collection tools and resources to increase rigor and reproducibility with Traumatic Brain Injury within the PRE Clinical Interagency reSearch resourcE - Traumatic Brain Injury (PRECISE-TBI). Please learn more about PRECISE-TBI at https://www.precise-tbi.org

Recent News Entries

Contact Us

Department of Neurosciences, School of Medicine

University of California, San Diego





About SciCrunch | Privacy Policy | Terms of Service

SciCrunch