Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pET15b-At 14-3-3 omicron Resource Report Resource Website |
RRID:Addgene_44926 | 14-3-3 omicron | Arabidopsis thaliana | Ampicillin | Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:13 | 0 | |||
|
pCMV-AD-uvr8at Resource Report Resource Website |
RRID:Addgene_44971 | AD-UVR8 | Arabidopsis thaliana | Ampicillin | PMID:23653191 | Backbone Marker:Stratagene; Backbone Size:3555; Vector Backbone:pCMV-AD; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted Methionine 1 | 2026-09-01 09:55:14 | 0 | |
|
pCMV-BD-cop1at(335-675) Resource Report Resource Website |
RRID:Addgene_44973 | BD-COP1 | Arabidopsis thaliana | Kanamycin | PMID:23653191 | Backbone Marker:Stratagene; Backbone Size:4251; Vector Backbone:pCMV-BD; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | deleted amino acids 1-334 | 2026-09-01 09:55:14 | 0 | |
|
pSNV2 CHER NLS cop1at(335-675) Resource Report Resource Website |
RRID:Addgene_44972 | mCherry-NLS-COP1 | Arabidopsis thaliana | Ampicillin | PMID:23653191 | Backbone Marker:Clontech; Backbone Size:4285; Vector Backbone:pSV2neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted amino acids 1-334 | 2026-09-01 09:55:14 | 0 | |
|
PhyB-mCherry-CDC10 Resource Report Resource Website |
RRID:Addgene_51568 | PhyB | Arabidopsis thaliana | Ampicillin | PMID:23761071 | There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. | Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1-908aa only | 2026-09-01 09:56:33 | 0 |
|
PhyB-mCherry-NLS Resource Report Resource Website 1+ mentions |
RRID:Addgene_51571 | PhyB | Arabidopsis thaliana | Ampicillin | PMID:23761071 | There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. | Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1-908aa only | 2026-09-01 09:56:33 | 1 |
|
linker-mCitrine-PIF6-NAT Resource Report Resource Website |
RRID:Addgene_51576 | PIF6 | Arabidopsis thaliana | Ampicillin | PMID:23761071 | the 11-aa linker is AAAGDGAGLIN | Backbone Size:3657; Vector Backbone:F6A-NAT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1-100aa of PIF6 | 2026-09-01 09:56:33 | 0 |
|
PhyB-mCherry-Spc72 Resource Report Resource Website |
RRID:Addgene_51582 | PhyB | Arabidopsis thaliana | Ampicillin | PMID:23761071 | There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. | Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1-908aa only | 2026-09-01 09:56:33 | 0 |
|
pENTR-AtMIR390a-B/c Resource Report Resource Website 1+ mentions |
RRID:Addgene_51778 | AtMIR390a-B/c | Arabidopsis thaliana | Chloramphenicol and Kanamycin | PMID:24647477 | Backbone Size:2580; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Kanamycin | A. thaliana MIR390a precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites. The BsaI site in the ccdB gene was mutated to block the site. | 2026-09-01 09:56:36 | 4 | |
|
pMDC123SB-AtMIR390a-B/c Resource Report Resource Website 1+ mentions |
RRID:Addgene_51775 | AtMIR390a-B/c | Arabidopsis thaliana | Chloramphenicol and Kanamycin | PMID:24647477 | Backbone Size:8754; Vector Backbone:pMDC123; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Kanamycin | A. thaliana MIR390a precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites. The BsaI site in the ccdB gene was mutated to block the site. | 2026-09-01 09:56:36 | 1 | |
|
pENTR-AtTAS1c-B/c Resource Report Resource Website 1+ mentions |
RRID:Addgene_51774 | AtTAS1c-B/c | Arabidopsis thaliana | Chloramphenicol and Kanamycin | PMID:24647477 | Backbone Size:2580; Vector Backbone:pENTR; Vector Types:GATEWAY-compatible entry clone; Bacterial Resistance:Chloramphenicol and Kanamycin | A. thaliana TAS1c precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites. The BsaI site in the ccdB gene was mutated to block the site. | 2026-09-01 09:56:36 | 1 | |
|
pUC119-gRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_52255 | guide RNA targeting AtPDS3 | Arabidopsis thaliana | Ampicillin | PMID:23929339 | gRNA target sequence GGACTTTTGCCAGCCATGGT This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper. | Backbone Size:3162; Vector Backbone:pUC119; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:56:42 | 6 | |
|
pAC-VIOL Resource Report Resource Website |
RRID:Addgene_53087 | zep | Arabidopsis thaliana | Chloramphenicol | PMID:24506237 | For better yield of low copy number pAC-based plasmids, grow liquid cultures on a platform shaker at ca. 30 degrees Celsius. When cultures reach early stationary phase, dilute 2-fold with growth medium, add spectinomycin (150 mg/liter), and "amplify" for several hours before harvest. For plasmid selection and maintenance in E. coli, use chloramphenicol at 30 mg/liter. | Backbone Marker:Francis X. Cunningham, Jr.; Backbone Size:10040; Vector Backbone:pAC-ZEAXipi; Vector Types:low copy number bacterial cloning vector; Bacterial Resistance:Chloramphenicol | Lacks codons for the first 60 N-terminal amino acids that are thought to comprise the chloroplast transit sequence | 2026-09-01 09:56:51 | 0 |
|
pAC-DELTA Resource Report Resource Website 1+ mentions |
RRID:Addgene_53273 | lcyE | Arabidopsis thaliana | Chloramphenicol | PMID:8798688 | For better yield of low copy number pAC-based plasmids, grow liquid cultures on a platform shaker at ca. 30 degrees Celsius. When cultures reach early stationary phase, dilute 2-fold with growth medium, add spectinomycin (150 mg/liter), and "amplify" for several hours before harvest. For plasmid selection and maintenance in E. coli, use chloramphenicol at 30 mg/liter. | Backbone Marker:Francis X. Cunningham, Jr.; Backbone Size:9476; Vector Backbone:pAC-LYC; Vector Types:low copy number bacterial cloning vector; Bacterial Resistance:Chloramphenicol | 2026-09-01 09:56:53 | 1 | |
|
pAtCHYb1Δ129N Resource Report Resource Website |
RRID:Addgene_53367 | chyB1 | Arabidopsis thaliana | Ampicillin | PMID:15659105 | Backbone Marker:Invitrogen; Backbone Size:4414; Vector Backbone:pTrcHis A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Deleted codons for the first 129 amino acids | 2026-09-01 09:56:54 | 0 | |
|
pAtLCYbSK Resource Report Resource Website |
RRID:Addgene_53588 | lcyB | Arabidopsis thaliana | Ampicillin | PMID:17085635 | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK-; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:56:57 | 0 | ||
|
y2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_53586 | lcyE | Arabidopsis thaliana | Ampicillin | PMID:8837512 | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK-; Vector Types:; Bacterial Resistance:Ampicillin | 2026-09-01 09:56:57 | 1 | ||
|
pCMV-CIB1-mRFP1-MP Resource Report Resource Website 1+ mentions |
RRID:Addgene_58367 | CIB1[1-147] | Arabidopsis thaliana | Kanamycin | PMID:24793453 | Backbone Marker:Clontech; Backbone Size:4742; Vector Backbone:pmCerulean-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:58:00 | 1 | ||
|
pCMV-CRY2(D387A)-mCherry Resource Report Resource Website |
RRID:Addgene_58369 | CRY2[1-498] (D387A) | Arabidopsis thaliana | Kanamycin | PMID:24793453 | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | D387A | 2026-09-01 09:58:00 | 0 | |
|
pCMV-CRY2-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_58368 | CRY2[1-498] | Arabidopsis thaliana | Kanamycin | PMID:24793453 | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:58:00 | 4 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.