Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
TB204 △metB proB74 Resource Report Resource Website |
RRID:Addgene_229551 | MG1655 attP21::PR-sfGFP::frt metB:frt proBA::proB74proA | n/a | None | PMID:40509754 | Primers for sequence verification of proB mutation: Fwd - prEP169, cgcggttatgtgaagaacgt Rev - prEP170, gtgatgtcgcgttataccgg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | in proB: Aspartic acid 107 mutated to asparagine (D107N) GAT->AAT | 2026-07-25 01:03:48 | 0 |
|
TB204 △metB Resource Report Resource Website |
RRID:Addgene_229549 | MG1655 attP21::PR-sfGFP::frt metB:frt | n/a | None | PMID:40509754 | Primers for sequence verification of metB knock-out: Fwd - prEP213, acgatcggtctggcttagtt Rev - prEP214, tgaccgtaaacccgcatagt Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 01:03:48 | 0 | |
|
TB204 △hisD Resource Report Resource Website |
RRID:Addgene_229548 | MG1655 attP21::PR-sfGFP::frt hisD:frt | n/a | None | PMID:40509754 | Primers for sequence verification of hisD knock-out: Fwd - prEP209, ccggttttacgcctgcatat Rev - prEP210, ccgaacgcccaactattctg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 01:03:48 | 0 | |
|
TB204 △trpC proB74 Resource Report Resource Website |
RRID:Addgene_229547 | MG1655 attP21::PR-sfGFP::frt trpC::frt proBA::proB74proA | n/a | None | PMID:40509754 | Primers for sequence verification of proB mutation Fwd - prEP169, cgcggttatgtgaagaacgt Rev - prEP170, gtgatgtcgcgttataccgg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | in proB: Aspartic acid 107 mutated to asparagine (D107N) GAT->AAT | 2026-07-25 01:03:48 | 0 |
|
TB204 △hisD proB74 Resource Report Resource Website |
RRID:Addgene_229550 | MG1655 attP21::PR-sfGFP::frt hisD:frt proBA::proB74proA | n/a | None | PMID:40509754 | Primers for sequence verification of proB mutation: Fwd - prEP169, cgcggttatgtgaagaacgt Rev - prEP170, gtgatgtcgcgttataccgg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | in proB: Aspartic acid 107 mutated to asparagine (D107N) GAT->AAT | 2026-07-25 01:03:48 | 0 |
|
bSLS.114 Resource Report Resource Website 1+ mentions |
RRID:Addgene_191530 | E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1 | E.coli | None | PMID:34949838 | Derived from BL21(AI), grow in LB in BSL1 laboratory conditions Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1 Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon) | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 12:55:39 | 2 | |
|
CLM24 ∆lpxM Resource Report Resource Website |
RRID:Addgene_132780 | None | PMID:33536221 | Genotype: W3110 ∆waaL ∆lpxM | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:55:41 | 0 | |||
|
BW-Para Resource Report Resource Website |
RRID:Addgene_172602 | None | PMID:34369028 | The BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays (after growing transformed cells on MOPS media). Plasmids encoding these chimeras are found at https://www.addgene.org/browse/article/28216962/. The protocol for the reporter assay is detailed in the manuscript. The genotype for BW-Para is [F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ-, rph-1, Δ(rhaD-rhaB)568, hsdR514], ΔlacI785::kan, ΔaraC771::kan, ΔrhaSR::(PBADmut:lacZ)]. The PBADmut:lacZ reporter construct integrated into the rhaSR KO locus comprises a synthetic Para-I promoter with -10/-35 sites of GATACT/TTTACA respectively and an ara-I DNA binding site proximal to the -35 site. The integrated 3.5 kb cassette coding for the reporter construct can be amplified from the genome using the primers: (forward) 5' - GGTGAAAGTTGGAACCTCTTAC - 3' and (reverse) 5'- GCGAGGAAGCGGAATATATCCCC - 3'. Cells should be freshly transformed prior to each assay. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:56:00 | 0 | |||
|
pMBA332 Resource Report Resource Website |
RRID:Addgene_214744 | BBa_J23119-RiboJ-RBS(21992)-gfpmut3 | other | None | PMID:38086386 | Please note: Plasmid contains three mutations in Rep101. These mutations are not known to affect plasmid function. | Vector Backbone:pSC101 ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2026-07-25 01:00:48 | 0 | |
|
pMBA333 Resource Report Resource Website |
RRID:Addgene_214745 | BBa_J23119-RiboJ-RBS(21992)-gfpmut3 | other | None | PMID:38086386 | Vector Backbone:p15A ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2026-07-25 01:00:48 | 0 | ||
|
pMBA329 Resource Report Resource Website |
RRID:Addgene_214749 | BBa_J23119-RBS(22821)-mcherry | other | None | PMID:38086386 | Please note: Plasmid contains mutations in the five C-terminal amino acids of mCherry. These mutations are not known to affect plasmid function. | Vector Backbone:colE1 ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2026-07-25 01:00:48 | 0 | |
|
ADP1-ISx Resource Report Resource Website |
RRID:Addgene_216551 | None | None | PMID:28667117 | The edited genome file is available on this GitHub repository: https://github.com/barricklab/Abaylyi-EE. | Vector Backbone:None; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:00:51 | 0 | ||
|
eScaf Resource Report Resource Website |
RRID:Addgene_220921 | Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13 | E. coli | None | PMID:38499480 | Primers for validation Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product) Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product) | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:01:18 | 0 | |
|
MG1655-OptoCre-bla-P-R Resource Report Resource Website |
RRID:Addgene_188474 | P-R-lox-TT-lox-bla | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:56:28 | 0 | ||
|
MG1655-OptoCre-knt-P-R Resource Report Resource Website |
RRID:Addgene_188475 | P-R-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:56:28 | 0 | ||
|
MG1655-OptoCre-knt-P*-R Resource Report Resource Website |
RRID:Addgene_188476 | P*-R-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:56:28 | 0 | ||
|
E. coli MEV15 Resource Report Resource Website |
RRID:Addgene_197112 | None | E. coli MEV15 is engineered to host sesquiterpenoid biosynthetic pathways. Sesquiterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Sesquiterpenoid production can be induced by IPTG, vanillic aci, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and E. coli ispA inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:58:09 | 0 | ||||
|
B-95.ΔAΔfabR Resource Report Resource Website |
RRID:Addgene_197934 | RNA polymerase gene (T7 phage)/chromosome | None | PMID:25982672 | Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR. | Vector Backbone:BL21(DE3); Vector Types:; Bacterial Resistance:None | 2026-07-25 12:56:46 | 0 | ||
|
MG1655-Chromosomal rfp reporter Resource Report Resource Website |
RRID:Addgene_251806 | E. coli K-12 MG1655 | n/a | None | Primers used for Colony PCR Verification: Forward primer = CGTGAGCGGTAAAGTTGTTG Reverse primer = CGGAGCTGCAAGGTGTTTATAG | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 01:06:50 | 0 | ||
|
SHARK2 Resource Report Resource Website |
RRID:Addgene_248173 | N/A | None | PMID:41529903 | K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-B0033-PirWT-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint. | Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 01:05:50 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
