Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 5 showing 81 ~ 100 out of 210 results
Snippet view Table view Download 210 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_209018

http://www.addgene.org/209018

Species: Escherichia coli
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
References:
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain. We designed a pair of primers to check the presence of P2 lysogen in this strain: - P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’ - P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’ These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).

Proper citation: RRID:Addgene_209018 Copy   


http://www.addgene.org/234622

Species: n/a
Genetic Insert: MG1655.ΔTAG.ΔTGA.ΔprfA.mprfB3.A37G-tRNA-Trp
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_234622 Copy   


  • RRID:Addgene_232335

http://www.addgene.org/232335

Species: Plasmodiophora brassicae
Genetic Insert: PbGH3
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:10141; Vector Backbone:pMDC32; Vector Types:Plant Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_232335 Copy   


  • RRID:Addgene_231247

http://www.addgene.org/231247

Species: Mycobacterium tuberculosis
Genetic Insert: PPE18-ALFA
Vector Backbone Description: Backbone Marker:Bryson Lab; Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_231247 Copy   


  • RRID:Addgene_231246

http://www.addgene.org/231246

Species: Mycobacterium tuberculosis
Genetic Insert: PPE18-HA
Vector Backbone Description: Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_231246 Copy   


http://www.addgene.org/229771

Species: Homo sapiens
Genetic Insert: Human collagen type IV alpha 4 chain (COL4A4)
Vector Backbone Description: Backbone Marker:Fujifilm/Wako; Vector Backbone:pEBMulti-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_229771 Copy   


  • RRID:Addgene_233024

http://www.addgene.org/233024

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:2996; Vector Backbone:pUMN105; Vector Types:; Bacterial Resistance:Hygromycin
References:
Comments: Please visit https://doi.org/10.64898/2026.01.22.701086 for bioRxiv preprint.

Proper citation: RRID:Addgene_233024 Copy   


  • RRID:Addgene_104623

http://www.addgene.org/104623

Species: Synthetic
Genetic Insert: crRNA to ligD
Vector Backbone Description: Vector Backbone:pMN016; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin
References:
Comments: Shuttle vector Mycobacterium smegmatis/E.coli

Proper citation: RRID:Addgene_104623 Copy   


  • RRID:Addgene_104907

    This resource has 1+ mentions.

http://www.addgene.org/104907

Species: Other
Genetic Insert: HH - FS23 linker - HDV
Vector Backbone Description: Vector Backbone:Episomal ARS/CEN Backbone; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Hygromycin
References:
Comments: Additional Publication: Prielhofer, R. etal (2017) BMC Syst Biol. 11,123 (PMID:29221460)

Proper citation: RRID:Addgene_104907 Copy   


  • RRID:Addgene_104912

    This resource has 1+ mentions.

http://www.addgene.org/104912

Species: Other
Genetic Insert: HH - FS23 linker - HDV
Vector Backbone Description: Vector Backbone:Episomal ARS/CEN Backbone; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Hygromycin
References:
Comments: Additional Publication: Prielhofer, R. etal (2017) BMC Syst Biol. 11,123 (PMID:29221460)

Proper citation: RRID:Addgene_104912 Copy   


  • RRID:Addgene_84690

http://www.addgene.org/84690

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Wilmanns lab; Backbone Size:6902; Vector Backbone:pMyNT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_84690 Copy   


http://www.addgene.org/89179

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Ghader Bashiri; Backbone Size:4920; Vector Backbone:pYUB28b Addgene #37277; Vector Types:Bacterial Expression, mycobacteria shuttle vector; Bacterial Resistance:Hygromycin
References:
Comments: Plasmid contains 2 His tags within the multiple cloning site. Please see plasmid map from depositing laboratory above for details. This plasmid is identical to pYUB28b Plasmid #37277, except that a single change was introduced to the MCS (NcoI in the original plasmid is replaced by SphI in this version of the plasmid).

Proper citation: RRID:Addgene_89179 Copy   


  • RRID:Addgene_89178

http://www.addgene.org/89178

Species:
Genetic Insert: none
Vector Backbone Description: Backbone Marker:Ghader Bashiri; Backbone Size:6040; Vector Backbone:pYUB28b Addgene #37277; Vector Types:Bacterial Expression, mycobacteria shuttle vector; Bacterial Resistance:Hygromycin
References:
Comments: Plasmid contains 2 His tags within the multiple cloning site. Please see plasmid map from depositing laboratory above for details. Note that the MBP tag in this plasmid is a surface entropy reduced version of the tag in order to help crytallisation down the line, and therefore has 6 alanine substitutions compared to the standard MBP sequence.

Proper citation: RRID:Addgene_89178 Copy   


  • RRID:Addgene_90276

    This resource has 1+ mentions.

http://www.addgene.org/90276

Species: A .niger
Genetic Insert: gRNA (pyrg1)
Vector Backbone Description: Backbone Size:5997; Vector Backbone:BB3_AMA_2.8_pUC-ORI_L_AC_hph; Vector Types:Bacterial Expression, A. niger; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_90276 Copy   


  • RRID:Addgene_98545

http://www.addgene.org/98545

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:3287; Vector Backbone:BB3; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_98545 Copy   


  • RRID:Addgene_98544

http://www.addgene.org/98544

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:3287; Vector Backbone:BB3; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_98544 Copy   


  • RRID:Addgene_98547

http://www.addgene.org/98547

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:3287; Vector Backbone:BB3; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_98547 Copy   


  • RRID:Addgene_186347

    This resource has 1+ mentions.

http://www.addgene.org/186347

Species: Synthetic
Genetic Insert: mCherry-CAAX
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_186347 Copy   


  • RRID:Addgene_186346

http://www.addgene.org/186346

Species: Synthetic
Genetic Insert: mCherry-3xNLS
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_186346 Copy   


  • RRID:Addgene_87830

http://www.addgene.org/87830

Species:
Genetic Insert: hyg
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:6300; Vector Backbone:pACBSR, which is based on pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
References:
Comments:

Proper citation: RRID:Addgene_87830 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X