Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli DH5A
Genetic Insert: PatoG
Vector Backbone Description: Backbone Marker:Oxford Genetics; Vector Backbone:OG241; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34289076
Comments: Capillary sequence files used the primers CATCTTCGATGGATAGCGATT and TGTACGGGATCTCCTTCTCG to verify MCS region including the promoter and the start codon of daGFP.
Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
Proper citation: RRID:Addgene_72839 Copy
Species: E. coli DH5A
Genetic Insert: PatoM
Vector Backbone Description: Backbone Marker:Oxford Genetics; Vector Backbone:OG241; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34289076
Comments: Capillary sequence files used the primers CATCTTCGATGGATAGCGATT and TGTACGGGATCTCCTTCTCG to verify MCS region including the promoter and the start codon of daGFP. Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
Proper citation: RRID:Addgene_72842 Copy
Species: E. coli DH5A
Genetic Insert: PatoK
Vector Backbone Description: Backbone Marker:Oxford Genetics; Vector Backbone:OG241; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34289076
Comments: Capillary sequence files used the primers CATCTTCGATGGATAGCGATT and TGTACGGGATCTCCTTCTCG to verify MCS region including the promoter and the start codon of daGFP.
Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
Proper citation: RRID:Addgene_72840 Copy
Species: E. coli DH5A
Genetic Insert: PatoM
Vector Backbone Description: Vector Backbone:LOG241; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34289076
Comments: Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
Proper citation: RRID:Addgene_72847 Copy
Species: E. coli DH5A
Genetic Insert: PatoK
Vector Backbone Description: Backbone Marker:Oxford Genetics; Vector Backbone:LOG241; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34289076
Comments: Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
Proper citation: RRID:Addgene_72848 Copy
Species: Homo sapiens
Genetic Insert: Target of rapamycin complex 2 subunit MAPKAP1, isoform 2
Vector Backbone Description: Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28143890
Proper citation: RRID:Addgene_72908 Copy
Species: Homo sapiens
Genetic Insert: mSin1.1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28143890
Comments: mSin1.1 was amplified from HEK293 cDNA library
Proper citation: RRID:Addgene_72907 Copy
Species: Homo sapiens
Genetic Insert: hBACCS2-IRES-mCherry
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4581; Vector Backbone:pWPRE/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26282514
Proper citation: RRID:Addgene_72892 Copy
Species: Homo sapiens
Genetic Insert: hBACCS2-IRES-GFP
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4581; Vector Backbone:pWPRE/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26282514
Proper citation: RRID:Addgene_72891 Copy
Species: Drosophila melanogaster
Genetic Insert: dmBACCS2VL-IRES-dOrai-IRES-GFP
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4581; Vector Backbone:pWPRE/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26282514
Comments: dmBACCS2VL is a slow recovery kinetic mutant of dmBACCS2.
Proper citation: RRID:Addgene_72897 Copy
Species: Drosophila melanogaster
Genetic Insert: dmBACCS2-IRES-dOrai-IRES-mCherry
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4581; Vector Backbone:pWPRE/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26282514
Proper citation: RRID:Addgene_72894 Copy
Species: Drosophila melanogaster
Genetic Insert: dmBACCS2NS-IRES-dOrai-IRES-GFP
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4581; Vector Backbone:pWPRE/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26282514
Comments: dmBACCS2NS is a fast recovery kinetic mutant of dmBACCS2.
Proper citation: RRID:Addgene_72895 Copy
Species: Homo sapiens
Genetic Insert: Galectin-3
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23921551
Comments: This plasmid is used to detect ruptured lysosomal membrane by lysosomotropic agents or endosomal membrane accompanied with invading bacteria.
Proper citation: RRID:Addgene_73080 Copy
Species: Bacillus cereus ATCC 14579
Genetic Insert: pET24a
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET24; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21531795
Comments: Cells were harvested via centrifugation, resus-pended in 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, and 0.1 mMdithiothreitol(DTT) (TED), and frozen at -80°C. Following thawing, cells were lysed bymicrofluidization and cell debris was removed by centrifugation. The lysate wasfractionated by first bringing the solution to 30% saturation, discarding thepellet, and then subsequently increasing the saturation to 60% and 90% with(NH4)2SO4and dissolving the precipitates in TED. The protein was further
purified using hydrophobic interaction chromatography over a HiPrep 16/10phenyl FF (high sub) column (GE Healthcare), dialyzed against TED, andsubjected to anion exchange chromatography over a Source Q column (GEHealthcare). The eluted protein was passed over a HiPrep 26/60 Sephacryl S100HR column (GE Healthcare) for size exclusion.
The structure was determined by X-ray Crystallography and deposited in the PDB as 3Q1P 3Q4I
Proper citation: RRID:Addgene_73161 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates and protocols
Proper citation: RRID:Addgene_73169 Copy
Species: Homo sapiens
Genetic Insert: XRN1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4174; Vector Backbone:pLNHA-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23142987
Proper citation: RRID:Addgene_66596 Copy
Species: Homo sapiens
Genetic Insert: Sec16B
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22355596
Proper citation: RRID:Addgene_66607 Copy
Species: Homo sapiens
Genetic Insert: COL1A1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11884515
Comments: Insert contains T1434S compared to all available reference sequences. Depositor states that this discrepancy does not affect plasmid function.
Proper citation: RRID:Addgene_66602 Copy
Species: Homo sapiens
Genetic Insert: TPST2
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18522538
Comments: Molecular cloning of TPST (tyrosylprotein sulfotransferase)–EGFP (enhanced green fluorescent protein)
The TPST1 and TPST2 sequences were obtained from human ESTs (expressed sequence tags) from the RZPD (Deutsches Ressourcenzentrum für Genomforschung, Berlin, Germany; GenBank® accession numbers NM_003596 and AF061254 respectively). TPST1–EGFP and TPST2–EGFP were obtained by PCR using the following primers: plus strand, 5′-GGGGCTCGAGATGGTTGGAAAGCTGAAG-3′, and minus strand, 5′-GGGGCTGCAGCTCCACTTGCTCAGTC-3′ for TPST1; and plus strand, 5′-GGGGCTCGAGATGCGCCTGTCGGTGC-3′, and minus strand, 5′-GGGGCTGCAGCGAGCTTCCTAAGTGG-3′ for TPST2 (XhoI and PstI, restriction sites are underlined). PCR products were purified and ligated into the pGEM-T-Easy vector (Promega) following the manufacturer's instructions. Positive clones were digested with XhoI and PstI, and the fragments obtained were inserted in the corresponding sites of pEGFP-N1 (Clontech). All constructs were verified by double-strand DNA sequencing (MWG Biotech, Ebersburg, Germany). Two differences to the published sequence of TPST2 were identified (276C>T and 1002T>C, relative to the start codon), but neither of which affect the predicted protein sequence.
Insert contains T370A relative to reference sequence. The depositing laboratory does not know the effect of this substitution on gene function
Proper citation: RRID:Addgene_66618 Copy
Species: Mus musculus
Genetic Insert: Sec23B
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22355596
Comments: Depositor states that mutations do not not affect function.
Proper citation: RRID:Addgene_66615 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
